Application of CRISPR gene editing combined PD-1 antibody in cancer treatment

A PD-1 and monoclonal antibody technology, which is applied in the fields of antibody medical components, antibodies, genetic engineering, etc., can solve the problems of limited alternatives and achieve good inhibition and good therapeutic effect

Active Publication Date: 2021-12-24
范德里希(上海)生物科技有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] At present, there are not many ways to use CRISPR / Cas technology to treat breast cancer and CRISPR combined with other drugs, and the options are limited. Therefore, it is urgent to develop new treatments to enrich the types of options

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CRISPR gene editing combined PD-1 antibody in cancer treatment
  • Application of CRISPR gene editing combined PD-1 antibody in cancer treatment
  • Application of CRISPR gene editing combined PD-1 antibody in cancer treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The preparation of embodiment 1 specific sgRNA

[0038] According to the gene sequence of human VEGF, using the design rules of gRNA, the sgRNA sequence was designed and prepared in a manual and online way.

[0039] In order to enhance the specificity of gene knockout and specifically knock out the coding region that destroys VEGF, this experiment adopted a 2hitKO strategy for gene knockout, that is, designing one sgRNA at an appropriate position upstream and downstream of the coding region, and then assembling the two sgRNAs into the same Cas9 Expression vector. Two sgRNA sequences were designed for the VEGF gene, and a BsmBI restriction site was added at the 5' end of the sense and antisense strands of the sequences. The designed sgRNA primers are shown in Table 1.

[0040] Table 1 The sequence of sgRNA primers for specific knockout of VEGF gene

[0041] Primer name Primer sequence (5'-3') bp VEGF-sgRNAa-F CACCGCAGGCTGCACCCATGGCAGA 25 VEGF...

Embodiment 2

[0043] Construction and transfection of embodiment 2 expression vector

[0044] The two sgRNAs prepared by annealing in Example 1 were respectively digested with BsmBI, and then mixed and ligated with the purified lentiCRISPR v2 vector (the LentiCRISPR V2 vector contains a U6 promoter that guides gene transcription, Cas9 nuclease, ampicillin, etc. components, see figure 1 shown). Under the action of T4 DNA ligase, ligate at 16°C for 16h. Take the ligation product and transform it into 100 μl DH5α competent bacteria, screen the positive clones with ampicillin resistance, pick a single clone, and send it to BGI for sequencing. The gene sequence was identified and the construction was successful.

[0045] Human ovarian cancer cell line SK-OV-3 (product number EY-X0733, Shanghai Yiyan Biotechnology Co., Ltd.), cultured in RPMI 1640 full culture medium containing 10% fetal bovine serum, at a constant temperature of 37°C and a saturated humidity of 5% CO2 Subculture in the incub...

Embodiment 3

[0047] Example 3 Cell Identification

[0048] Dilute the cells screened in Example 2 into a 96-well plate, digest with trypsin, collect the overgrown SK-OV-3 cells, resuspend in PBS, add 4×SDS lysate, boil in water bath for 15 minutes, and centrifuge at 12000r / min to collect Cleared for polyacrylamide gel electrophoresis. After electrophoresis, transfer to PVDF membrane, block with 5% skimmed milk powder at room temperature for 1 h, then add endogenous VEGF antibody at 1:500 and incubate at room temperature for 1 h; wash membrane with 1×TBST for 3 times, 5 min each time, use HRP-labeled goat antibody Mouse IgG (1:5000) was incubated at room temperature for 1 h, the membrane was washed 3 times with 1×TBST, 5 min each time, and the Western blot bands were detected by chemiluminescence. Normal cultured SK-OV-3 cells were used as control. The result is as figure 2 shown.

[0049] From figure 2 The results showed that the VEGF protein in the gene-edited cells was not express...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
affinityaaaaaaaaaa
Login to View More

Abstract

The invention relates to application of CRISPR gene editing combined PD-1 antibody in cancer treatment. According to the application, gRNA is designed for a VEGF target, VEGF genes are specifically knocked out in breast cancer cells, protein detection shows that the knockout effect is good, and VEGF protein is well inhibited. In addition, after the breast cancer cells with the VEGF genes knocked out are combined with PD-1 monoclonal antibody treatment, breast cancer tumors are better inhibited, and a good treatment effect is achieved.

Description

technical field [0001] The present invention relates to the field of biology, and more specifically, relates to the application of CRISPR gene editing combined with PD-1 antibody in the treatment of cancer. Background technique [0002] According to the latest global cancer burden data released by the International Agency for Research on Cancer (IARC) of the World Health Organization in 2020, the number of new breast cancers has reached 2.26 million, officially replacing lung cancer and becoming the most common cancer in the world! In my country, the incidence of breast cancer ranks first among all female malignancies. According to the "2015 China Cancer Registration Annual Report", the incidence rate of female breast cancer in my country is 42.55 per 100,000 people. It is estimated that by 2021, the number of breast cancer patients in China will reach 2.5 million. Breast cancer has become the number one killer of women's health and cannot be ignored. The overall incidence...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K45/06A61K39/395A61K31/7088A61P35/00C07K16/28C12N9/22C12N15/113
CPCA61K45/06A61K39/3955A61K31/7088A61P35/00C07K16/2818C12N15/1136C12N9/22C12N2310/20C07K2317/56C07K2317/569A61K2300/00
Inventor张冬久申冬昌
Owner范德里希(上海)生物科技有限公司