SNP locus significantly relevant to precocious puberty trait of eriocheir sinensis and application
A Chinese mitten crab, precocious technology, applied in the direction of recombinant DNA technology, microbial determination/inspection, DNA/RNA fragment, etc., can solve the problems affecting the breeding efficiency of river crabs, waste of feed, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 SNP screening of the 5'-flanking region sequence of the Vg gene and its correlation analysis with precocious puberty:
[0022] ①Preliminary screening of precocious puberty related SNP loci
[0023] 100 samples of normal and precocious crabs were randomly selected for genomic DNA extraction. Design primers to carry out PCR amplification to the 5'-flank region sequence of Vg gene, amplification primer is: Vg1F:ACTCTCGTCTATTTCCACTATC (SEQ ID NO.3); Vg1R:CCATCCTGCGACAATCAC (SEQ ID NO.4); Amplification length is 801bp, for The amplified PCR product was purified and bidirectionally sequenced, and the SNP site of the 5'-flanking regulatory region sequence of the Vg gene was screened and identified according to the sequencing results.
[0024] For the SNP sites found by sequencing, the trait-genotype association analysis of single loci (Logistic regression analysis based on the co-dominance model and additive model) was performed on the precocious and normal developm...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


