Check patentability & draft patents in minutes with Patsnap Eureka AI!

SNP locus significantly relevant to precocious puberty trait of eriocheir sinensis and application

A Chinese mitten crab, precocious technology, applied in the direction of recombinant DNA technology, microbial determination/inspection, DNA/RNA fragment, etc., can solve the problems affecting the breeding efficiency of river crabs, waste of feed, etc.

Active Publication Date: 2018-11-06
FRESHWATER FISHERIES RES INSITUTE OF JIANGSUPROVINCE
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, due to the existence of a large number of precocious first-year-old crabs, a huge waste of feed was also caused during the breeding stage of crab species, which seriously affected the benefits of river crab culture.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP locus significantly relevant to precocious puberty trait of eriocheir sinensis and application
  • SNP locus significantly relevant to precocious puberty trait of eriocheir sinensis and application
  • SNP locus significantly relevant to precocious puberty trait of eriocheir sinensis and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 SNP screening of the 5'-flanking region sequence of the Vg gene and its correlation analysis with precocious puberty:

[0022] ①Preliminary screening of precocious puberty related SNP loci

[0023] 100 samples of normal and precocious crabs were randomly selected for genomic DNA extraction. Design primers to carry out PCR amplification to the 5'-flank region sequence of Vg gene, amplification primer is: Vg1F:ACTCTCGTCTATTTCCACTATC (SEQ ID NO.3); Vg1R:CCATCCTGCGACAATCAC (SEQ ID NO.4); Amplification length is 801bp, for The amplified PCR product was purified and bidirectionally sequenced, and the SNP site of the 5'-flanking regulatory region sequence of the Vg gene was screened and identified according to the sequencing results.

[0024] For the SNP sites found by sequencing, the trait-genotype association analysis of single loci (Logistic regression analysis based on the co-dominance model and additive model) was performed on the precocious and normal developm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP locus significantly relevant to the precocious puberty trait of eriocheir sinensis and the application. The SNP locus is positioned in a Vg gene 5'-flanking region-437bpposition of the eriocheir sinensis, and nucleotide variation information is SNP g.-437T) G. PCR primer used for detecting the SNP locus is SEQ ID NO.1 and SEQ ID NO.2, and restriction enzyme is MboI.The SNP locus has significant correlation with precocious puberty of the eriocheir sinensis, and the risk of precocious puberty trait of GG gene eriocheir sinensis individual is obviously smaller than that of precocious puberty trait of TT gene individual. The SNP locus and the PCR primer used for genetic typing are applied to the predication of the risk of precocious puberty of the eriocheir sinensis and / or the variety breeding of the eriocheir sinensis.

Description

technical field [0001] The invention belongs to the field of aquaculture genetic engineering, and relates to a SNP site significantly related to the precocious trait of Chinese mitten crab and its application. Background technique [0002] Chinese mitten crab (Eriocheir sinensis), commonly known as river crab, is one of the most important freshwater aquaculture species in my country. Precocious puberty is one of the bottleneck problems that affect the current efficiency of river crab breeding. During the breeding process, the gonads of young precocious crabs mature in the same year, and cannot continue to moult smoothly, and their weight growth is slow or even stagnant. Most of them die during April to May of the following year. , can no longer continue to raise to the size of 2-year-old adult crabs. In addition, due to the existence of a large number of precocious first-year-old crabs, a huge waste of feed was also caused during the breeding stage of crab species, which se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 徐宇许志强林海邓燕飞李旭光陆全平潘建林
Owner FRESHWATER FISHERIES RES INSITUTE OF JIANGSUPROVINCE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More