Supercharge Your Innovation With Domain-Expert AI Agents!

Application of cynoglossus semilaevis gender difference indication label

A semi-smooth tongue sole and gender technology is applied in the application field of fish biology and marine fish semen exosome markers, which can solve the problems of differential identification of biomarkers, less research and other problems, and achieve the effect of reliable identification results.

Active Publication Date: 2018-12-21
TIANJIN BOHAI SEA FISHERIES RES INST
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, there are relatively few studies on microRNAs derived from exosomes as biomarkers in marine animals. The present invention develops a method for the extraction and preliminary application of exosomes derived from the semen of marine fish represented by half-smooth tongue sole, and solves the problem of male half-smooth tongue sole. The problem of differential identification of biomarkers in semen exosomes of fish and pseudo-male fish is innovative

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of cynoglossus semilaevis gender difference indication label
  • Application of cynoglossus semilaevis gender difference indication label
  • Application of cynoglossus semilaevis gender difference indication label

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Screening and identification of a semi-smooth tongue sole seminal exosomal miRNAs as biomarkers

[0024] 1. Collection of semen samples

[0025] Collect 0.5 ml of semen from sexually mature males of semi-smooth tongue sole in a centrifuge tube for the isolation and identification of exosomes.

[0026] 2. Extraction of exosomes

[0027] (1) Transfer 0.5ml of the semen sample to a 1.5ml EP tube, place at 4°C, centrifuge at 1200g for 15min to remove sperm cells, centrifuge at 15000g at 4°C for 20min to remove small cell impurities and debris, dilute 1 time with PBS, and use a 0.45um filter membrane Perform pre-filtration, and then filter the filtrate through a 0.22um membrane filter.

[0028] (2) Exosomes were extracted from the sample using the Total Exosome Isolation Kit.

[0029] (3) After centrifugation, the supernatant was removed, and the lysed sample was collected and completely transferred to a RNase-free 2ml tube.

[0030] 3. Identification of exosomes: Hitach...

Embodiment 2

[0036] Random identification of male and pseudo-male fishes using microRNA markers in the seminal plasma exosomes of half-smooth tongue sole

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of a cynoglossus semilaevis gender difference indication label, belonging to the field of fish biotechnology. A micro ribonucleic acid (miRNA) gender label is sdre-miR-141-3p, and a sequence is TAACACTGTCTGGTAACGATGC; the problem of distinguishing reproductive genetic differences between male cynoglossus semilaevis and female pseudo-male cynoglossus semilaevisis solved. The marker miRNAs have the characteristic of significant difference expression of male fish and female pseudo-male fish, and are specific molecular recognition markers.

Description

technical field [0001] The invention belongs to the field of fish biotechnology, in particular to the field of application of seawater fish semen exosome markers. Background technique [0002] Semi-smooth tongue sole (Cynoglossus semilaevis) is a unique offshore sea-dwelling fish in my country's waters, and it is also an important rare marine fish because of its delicious taste and rich nutrition. [0003] Semi-smooth tongue sole is a flounder, the growth speed of female and male fish is very different, and the growth speed of female is 2-4 times that of male. The characteristics of slow growth and small size of male fish of tongue sole reduce the breeding yield of tongue sole and increase the cost of breeding. The male proportion of tongue sole can even reach 80%-90%. Studies have found that among the 80%-90% male fish, a considerable part is pseudo male fish. Normal males of half smooth tongue sole have chromosomes of ZZ type, and normal females have chromosomes of ZW ty...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6879C12Q1/6888
CPCC12Q1/6879C12Q1/6888C12Q2600/178
Inventor 张博赵娜贾磊刘克奉李仰真孙金生
Owner TIANJIN BOHAI SEA FISHERIES RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More