Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting single cell mitochondrial copy number

A detection method and mitochondrial technology, which are applied in the fields of biochemical equipment and methods, and the determination/inspection of microorganisms, can solve the problems of uncertain definition of the measurement unit of chrM, undetectable ratio, inconsistent results, etc., and achieve short detection cycle, operation Simple, specific effects

Inactive Publication Date: 2019-01-15
THE FIRST AFFILIATED HOSPITAL OF ZHENGZHOU UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The reported quantitative techniques for mtDNA have the following shortcomings: (1) DNA extraction is required; (2) detection techniques are mostly aimed at somatic cells and blood samples, and the detection accuracy is low, and a large number of samples are required for detection; (3) the use of model simulation There are many influencing factors, different models and different experimental procedures produce inconsistent results; (4) the definition of the measurement unit of chrM is uncertain; (5) the current results are inconsistent when applied to embryos, eggs, and single cells. Stable, and can only detect the copy number of mitochondria but not the ratio

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting single cell mitochondrial copy number
  • Method for detecting single cell mitochondrial copy number
  • Method for detecting single cell mitochondrial copy number

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0036] The single-cell mitochondrial copy number detection method of the present invention comprises the following steps:

[0037] (1) Design of probes and primers: Design corresponding primers for the mitochondrial DNA 11778 site. First, design a pair of primers with a product of about 1000 bp in the upstream and downstream sequences of the mitochondrial DNA 11778 site as primers for standard preparation (sequence 1 and Sequence 2); A pair of Taqman probes were designed for the G>A mutation at the mitochondrial DNA 11778 site, including the VIC probe without the mutation (Sequence 3), the FAM probe with the mutation (Sequence 4) and the primers required for the probe (Sequence 5 and Sequence 6),

[0038] The primer sequences are as follows:

[0039] Sequence 1: CAACAAACCTATTTAGCTGTTCCCC;

[0040] Sequence 2: GTAAGGCGAGGTTAGCGAGG;

[0041] Sequence 3: CACAGTCGCATCATA (Taqman probe whose fluorophore is VIC and quenching group is MGB);

[0042] Sequence 4: ACTCACAGTCACATCA (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for detecting single cell mitochondrial copy number comprise that following steps of: (1) designing primer and probes: designing a pair of primers (SEQ ID NO: 1 and SEQ ID NO: 2) of about 1000 bp for product length for standard preparation according to mitochondrial DNA 11778 site G) A mutation; designing a pair of Taqman probes (SEQ ID NO: 3-6) for detection; (2) Single cell lysis and detection: Taqman quantitative detection is performed directly after the sample is treated with the prepared lysis solution; (3) Data analysis: The mitochondrial copy number is calculated by the standard curve method of Ct value. The invention has the advantages of simple operation steps, low technical level requirement for operators, simple data analysis method, and can be analyzed as long as basicExcel knowledge is possessed. The invention solves the purpose of detecting single cell mitochondrial copy number in clinic, and is suitable for clinical popularization. The invention has the advantages of simple operation steps, low technical level requirement for operators, and simple data analysis method.

Description

technical field [0001] The invention relates to a single-cell mitochondrial copy number detection method. Background technique [0002] Mitochondria is an important organelle for eukaryotic cells to generate energy. It contains its own genome and has a relatively independent DNA replication, transcription and translation system. It is a semi-autonomous cell line and is responsible for cellular energy metabolism and free radical generation. Mitochondria contain their own DNA. Mammalian mitochondrial DNA (MitochondrialDNA, mtDNA) is a double-stranded closed-loop molecule with a full length of about 16569bp. It contains 37 genes and 1 non-coding control region. This region is the D loop, which has the control mtDNA Regulatory sequences for transcription and translation. There is only one set of nuclear genome in each cell, but there can be hundreds of mitochondria, and each mitochondria contains 1-15 mtDNA molecules. The normal operation of the oxidative respiratory chain of c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6827
CPCC12Q1/6827C12Q2561/101C12Q2563/107
Inventor 孙莹璞张玫翔姚桂东马雪山徐家伟
Owner THE FIRST AFFILIATED HOSPITAL OF ZHENGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products