Siglec-9 targeted embedding antigen receptor T cell and purpose thereof

A chimeric antigen receptor, host cell technology, applied in receptors/cell surface antigens/cell surface determinants, polypeptides containing localization/targeting motifs, animal cells, etc., can solve the unsatisfactory treatment effect And other issues

Active Publication Date: 2019-02-12
EAST CHINA NORMAL UNIV +1
View PDF10 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Chimeric antigen receptor T cell therapy (CAR-T therapy) is currently the most popular cellular immunotherapy in the world. This therapy modifies T cell receptors so that T cells can specifically recognize and kill tumor cells. It is currently in Acute lymphoblastic leukemia and non-Hodgkin's lymphoma have achieved good clinical treatment effects, but the treatment effect on solid tumors is not satisfactory and still faces great challenges

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Siglec-9 targeted embedding antigen receptor T cell and purpose thereof
  • Siglec-9 targeted embedding antigen receptor T cell and purpose thereof
  • Siglec-9 targeted embedding antigen receptor T cell and purpose thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0185] Example 1 Obtaining Siglec-9 Extracellular Gene Sequence

[0186] The present invention screens an extracellular segment gene sequence from Siglec-9 full-length gene sequence through a large number of screening. The primers were designed with SnapGene software and synthesized in the company. Using the cDNA of the NK-92 cell line as a template, the extracellular segment of Siglec-9 was amplified by RT-PCR, and the RT-PCR product was sequenced to obtain the extracellular segment of Siglec-9 The sequence is as follows:

[0187] ATGCTGCTGCTGCTGCTGCCCCTGCTCTGGGGGAGGGAGAGGGCGGAAGGACAGACAAGTAAACTGCTGACGATGCAGAGTTCCGTGACGGTGCAGGAAGGCCTGTGTGTCCATGTGCCCTGCTCCTTCTCCTACCCCTCGCATGGCTGGATTTACCCTGGCCCAGTAGTTCATGGCTACTGGTTCCGGGAAGGGGCCAATACAGACCAGGATGCTCCAGTGGCCACAAACAACCCAGCTCGGGCAGTGTGGGAGGAGACTCGGGACCGATTCCACCTCCTTGGGGACCCACATACCAAGAATTGCACCCTGAGCATCAGAGATGCCAGAAGAAGTGATGCGGGGAGATACTTCTTTCGTATGGAGAAAGGAAGTATAAAATGGAATTATAAACATCACCGGCTCTCTGTGAATGTGACAGCCTTGACCCACAGGCCCAACATCCTCATCCCAGGCAC...

Embodiment 2

[0188] Example 2 Construction of pCDH-exSiglec-9-CAR2-IRES-zsGREEN vector

[0189] The extracellular segment sequence of Siglec-9 obtained in Example 1 and the second-generation CAR sequence (CD8-CD3zeta-4-1BB) that have been constructed by our laboratory were linked together by overlapping PCR. The exSIGLEC-9-CAR2 sequence was ligated to the PLVX vector by means of restriction enzymes XhoI and XbaI. Then the exSIGLEC-9-CAR2-IRES-zsGREEN sequence on the PLVX-exSiglec-9-CAR2-IRES-zsGREEN vector was digested with BamH I and SalI and connected to the PCDH vector.

[0190] The specific method is as follows: First, cut the PLVX-exSiglec-9-CAR2-IRES-zsGREEN vector with XhoI and XbaI to recover the exSIGLEC-9-CAR2-IRES-zsGREEN fragment, then fill in the sticky ends with Klenow enzyme, and then use CIP enzyme Remove phosphorylation. At the same time, the empty pCDH vector was digested with BamHI and Sal I to recover large fragments. The sticky ends were also filled in with Klenow enzyme,...

Embodiment 3

[0193] Example 3 Virus packaging

[0194] PCDH and PCDH-exSiglec-9-CAR2-IRES-zsGREEN plasmid amplification and virus packaging

[0195] 3.1 Plasmid transfection

[0196] 1) Place the plasmid, PEI, and Opti-MEM medium at room temperature for 5 minutes;

[0197] 2) Take 436μl of Opti-MEM in a 1.5ml EP tube, add 64μg PEI to mix, and let it stand at room temperature for 5 minutes;

[0198] 3) Take 12μg of vector plasmid PCDH and PCDH-exSiglec-9-CAR2-IRES-zsGREEN, 8μg psPA×2, 4μg pMD2.G, add Opti-MEM to 500μl, and let stand at room temperature for 5min;

[0199] 4) Add the prepared PEI-Opti-MEM solution to the Opti-MEM containing the plasmid, and let it stand at room temperature for 20 minutes;

[0200] 5) Slowly drip 1ml DNA / PEI mixture into the 293T petri dish laid the day before, mix gently, incubate at 37°C incubator, change the fresh medium after 6-8h, and put it in 37°C incubator to continue incubating .

[0201] 3.2 Virus collection and concentration

[0202] 1) 48 hours after plasmid tr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a siglec-9 targeted embedding antigen receptor T cell and a purpose thereof. Concretely, the invention provides a Siglec-9 extracellular protein, a targeted MUC1 targeted CARand an engineering immune cell. The engineering immune cell can selectively kill tumor cells of malignant tumor from high-expression MUC1.

Description

Technical field [0001] The present invention relates to the field of immunotherapy, in particular to a chimeric antigen receptor T cell targeted by Siglec-9 and its use. Background technique [0002] Chimeric antigen receptor T cell therapy (CAR-T therapy) is currently the world’s hottest cellular immunotherapy. This therapy modifies T cell receptors so that T cells can specifically recognize and kill tumor cells. Acute lymphocytic leukemia and non-Hodgkin’s lymphoma have had good clinical treatment effects, but the treatment effect on solid tumors is not satisfactory and still faces huge challenges. [0003] Therefore, there is an urgent need in the art to develop a chimeric antigen receptor T cell that has a significant killing effect on malignant solid tumors. Summary of the invention [0004] The purpose of the present invention is to provide a chimeric antigen receptor T cell with significant killing effect on malignant solid tumors. [0005] The first aspect of the present inv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/705C07K19/00C12N15/62C12N15/13C12N15/867A61K35/17A61P35/00
CPCA61P35/00A61K35/17C12N5/0636C12N15/86C07K14/70503C07K14/7051C07K2319/03C07K2319/21C12N2740/15043
Inventor江文正张红梅刘明耀席在喜
OwnerEAST CHINA NORMAL UNIV