Female acipenser schrenckii special DNA fragment and application
A sturgeon, fragment technology, applied in DNA/RNA fragment, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem of not identifying gender-specific markers, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Obtaining the specific DNA fragments of female Sturgeon's sturgeon:
[0023] 1. Low-coverage whole-genome sequencing scans the individual genomes of male and female stylized sturgeons: 20 male and female stylized sturgeons are identified by paraffin sections of gonad tissue, and their whole-genome DNA is extracted. Genomic DNA is randomly interrupted by ultrasonic waves, sequencing library preparation, and library quality Detection and sequencing on the Illumina sequencing platform to obtain the raw data of whole genome sequencing of male and female Sturgeon's sturgeon, and perform quality control on the raw data to obtain valid data;
[0024] 2. Use the K-mer method to analyze the genome data of the male and female groups to obtain candidate sex-specific fragments: First, cut the effective data of each individual into K-mers with a length of 21bp, and obtain 40 K-mer data with a length of 21bp Set, screen out female-specific K-mers that are not available in males as fe...
Embodiment 2
[0027] The detection method of the specific DNA fragment of the female Sturgeon's sturgeon:
[0028] The primers designed for ACSC-FS01 (SEQ ID NO.1) are:
[0029] ACSC-FS01F(5′-3′):ATAACATAGTTCATTAATAATGCCT
[0030] ACSC-FS01R(5'-3'):CGCCAACAGTGAATACGTT;
[0031] The corresponding PCR amplification conditions are:
[0032] Pre-denaturation at 95°C for 5min; followed by denaturation at 95°C for 30s, annealing at 56°C for 30s, extension at 72°C for 20s, amplification for 35 cycles, and extension at 72°C for 7min.
[0033] The primers designed for ACSC-FS02 (SEQ ID NO.2) are:
[0034] ACSC-FS02F(5′-3′):GGCCATAACTGTACATATAGAAC
[0035] ACSC-FS02R(5′-3′):CTTTCGATTATGCCGGACA
[0036] The corresponding PCR amplification conditions are:
[0037] Pre-denaturation at 95°C for 5min; followed by denaturation at 95°C for 30s, annealing at 54°C for 30s, extension at 72°C for 20s, amplification for 35 cycles, and extension at 72°C for 7min.
Embodiment 3
[0039] The application of the specific DNA fragment of female Stryckey's sturgeon or the primers designed for it in identifying the sex of Stryckey's sturgeon:
[0040] Firstly, the genome DNA of 24 fin rays of male and female Stryker's sturgeon was extracted by the high-salt method, and the integrity and concentration of the extracted DNA were detected by agarose electrophoresis and spectrophotometer;
[0041] The above-mentioned DNA was amplified by conventional PCR using the primers involved in Example 2. The amplification system was: about 10 ng of template DNA; 1.5 U of Taq polymerase; 2.5 μl of 10× amplification buffer; the concentrations of the four dNTPs were 200 μM respectively; The final concentration of the upstream and downstream primers is 0.2 μM; add ddH 2 0 to 25 μl.
[0042] Amplification results such as figure 1 and figure 2 Shown:
[0043] Regardless of the primers designed for SEQ ID NO.1 or the primers designed for SEQ ID NO.2, specific bands can be am...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com