Recombined poultry beta-defensin for inhibiting ALV-J virus infection

An ALV-J, virus infection technology, applied in the field of molecular immunology and virology, can solve the problems of chicken industry losses, economic losses, farm closures, etc., and achieve the effect of reducing direct and indirect economic losses

Inactive Publication Date: 2019-04-05
SHANDONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2000, subgroup J avian leukemia broke out in white-feathered broiler breeders in my country, causing huge economic losses; from 2002 to 2005, ALV-J virus broke through the interspecies barrier, causing Guangdong and Guangxi Sanhuang chickens and Chinese Ma chickens In 2007, hemangiomatosis closely related to J subgroup avian leukemia broke out in layer breeder flocks and commercia...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined poultry beta-defensin for inhibiting ALV-J virus infection
  • Recombined poultry beta-defensin for inhibiting ALV-J virus infection
  • Recombined poultry beta-defensin for inhibiting ALV-J virus infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Obtaining of recombinantly expressed AvBD protein

[0043] First, according to the gene sequences of chicken AvBD2 and chicken AvBD6, primers with restriction sites Not Ⅰ and EcoR Ⅰ were designed respectively. The primers used include:

[0044] AvBD2 primer F: 5'CCGGAATTCATGAGGATTCTTTACCT 3' (SEQ ID No.1);

[0045] AvBD2 primer R: 5'TTCTCGAGTTATGCATTCCAAGGC 3' (SEQ ID No.2);

[0046] AvBD6 primer F: 5'CCGGAATTCTGGAGAAGGGAGA 3' (SEQ ID No.3);

[0047] AvBD6 primer R: 5'TTGCGGCCGCTGGATGGAGTTAG 3' (SEQ ID No.4);

[0048] The part in italics is the restriction site;

[0049] The gene sequences of chicken AvBD2 and chicken AvBD6 were obtained from the whole chicken gene by gel electrophoresis PCR using the above primers, sequenced, and after successful comparison with the gene sequences of chicken AvBD2 and chicken AvBD6 in GenBank, AvBD was digested with double enzymes and connected to pGEX6p- 1 On the expression vector, the ligated product was transformed int...

Embodiment 2

[0065] Example 2 Verification of the recombinantly expressed AvBD protein

[0066] The positive bacteria containing the recombinant plasmid after sequencing were inoculated into LB liquid medium containing ampicillin (final concentration 10 μg / mL) (commercially purchased conventional medium containing 1% (w / v) Tryptone, 0.5% ( w / v) Yeast Extract, 1% (w / v) NaCl, 0.1mg / mL Kanamycin), shake at 37°C (8.11668×g), culture to OD600=1.0, add IPTG with a concentration of 500mMol to the whole medium IPTG The concentration was 1mmol / L, and the cultivation was continued at 37°C for 4h.

[0067] Collect the cultivated engineering bacteria liquid, centrifuge at 2683.2×g for 5 minutes, discard the supernatant, and resuspend the pellet with standard PBS to obtain a suspension; add standard PBS to the pellet according to the ratio of 100 mL of initial medium to 3 mL of standard PBS to obtain Resuspension. After resuspension, divide into 5mL centrifuge tubes with 3mL per tube. Place the cent...

Embodiment 3

[0105] Example 3 Recombinantly expressed AvBD protein in vitro cell anti-virus detection

[0106] 1) Select CEF cells in good condition and pass them to 12-well cell culture plate, each 3 wells as a group; there are 7 experimental groups, namely: Mock, ALV-J, 0.2μgAvBD2+ALV-J, 0.2μgAvBD6 +ALV-J, 0.1 μg AvBD2+ALV-J, 0.1 μg AvBD6+ALV-J, 0.1 μg AvBD2+0.1 μg AvBD6+ALV-J.

[0107] 2) After the CEF cells grew to 80%, the virus was inoculated into six groups respectively, and 2 hours after infection, they were replaced with 1% DMEM medium for maintenance.

[0108] 3) Maintain for 72 hours, then inoculate corresponding groups of poultry β-defensin protein into 5 of the two groups, and continue to maintain for 96 hours before collecting cells.

[0109] 4) Collect the CEF cells in 21 wells of the above 7 experimental groups, extract cellular RNA and lyse cellular protein.

[0110] qPCR detection:

[0111] Table 4 Real-time PCR primers

[0112]

[0113] Using the Real-time PCR SYB...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of molecular immunology and virology, and particularly provides a recombined poultry beta-defensin for inhibiting ALV-J virus infection. The defensin is anin-vitro prokaryotically expressed poultry beta-defensin, wherein chicken AvBD2 and chicken AvBD6 are subjected to recombined expression; it is found that two poultry beta-defensin proteins both havean inhibition effect on ALV-J viruses, then two poultry beta-defensins are combined according to the concentration of 1:1, and the combined poultry beta-defensin can significantly and synergisticallyinhibit infection of the ALV-J viruses in in-vitro cells and live chickens, and can be applied as an antiviral biological agent; and direct and indirect economic losses caused by ALV-J virus diseasescan be greatly lowered, the effect cannot be achieved by existing poultry disease prevention and treatment means, and meanwhile a new idea for prevention and treatment research of the poultry ALV-J viruses is initiated.

Description

technical field [0001] The invention relates to the technical fields of molecular immunology and virology, and specifically provides a recombinant poultry β-defensin for inhibiting ALV-J virus infection. Background technique [0002] Subgroup J avian leukemia is a neoplastic disease caused by subgroup J avian leukemia virus (ALV-J). ALV-J is a classical RNA virus with an envelope, and clinical infection in poultry mainly manifests as myeloid cell tumors, immune tolerance, high mortality and growth retardation. From 1997 to 1998, ALV-J broke out globally, causing a devastating blow to the world broiler breeder industry. In addition to myeloma caused by ALV-J infection, erythroblastoma, hemangioma, nephroma and sarcoma often occur in the late stage of infection, usually with a mortality rate of 1% to 5%, and the peak period can reach 50%. Studies have confirmed that ALV-J has persistent damage to the immune response, resulting in low productivity, frequent secondary infectio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/465C12N15/12C12N15/70A61P31/14
CPCC07K14/465A61P31/14
Inventor 成子强云骜
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap