Application of ulcerative colitis biological marker and treatment target spot

A technology for ulcerative colitis and biomarkers is applied in the application field of ulcerative colitis biomarkers and therapeutic targets, which can solve the problems of easy repetition, long drug treatment cycle, and easy generation of drug resistance, so as to improve the Survival rate, good application prospects

Inactive Publication Date: 2019-04-12
CHINA AGRI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Diet therapy is effective for mild ulcerative colitis, while drug therapy has a long cycle, is easy to repeat, and is prone to drug resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ulcerative colitis biological marker and treatment target spot
  • Application of ulcerative colitis biological marker and treatment target spot
  • Application of ulcerative colitis biological marker and treatment target spot

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Take 30 C57BL / 6 male mice (purchased from Speyford) about 8 weeks old, with an average body weight of more than 20g, and set up a control group and an experimental group. The experimental group is drinking water with 2.5% dextran sulfate sodium (dextran sulfate sodium, DSS) (U.S. MP company, article number 0216011080), the UC model was constructed by mice drinking freely for 5 days, and the blood in the stool was observed, and the mice were killed on the 0th day, the 1st day, the 3rd day, and the 5th day of induction, and the tissues were taken. The RNA level expression detection of NOC4L, the results show that after DSS induction, the RNA expression level of NOC4L in the colon is up-regulated, see figure 2 .

Embodiment 2

[0034] The inventors have found that NOC4L is highly expressed in inflammatory cells, and it is speculated that NOC4L is related to inflammatory diseases. In order to further study the role of NOC4L in mice, NOC4L knockout and overexpression mice were prepared by Nanjing Model Animal Center. Add loxp sites to both ends of the mouse exon3, and mate with macrophage-specific knockout lyz-cre tool mice to obtain macrophage-specific knockout LKO mice. Insert the Noc4l gene of the mouse into the lyz promoter (an element used to specifically enhance the expression of myeloid genes), and insert the insulator (an element that plays a key role in regulating the specific expression of Noc4l) on both sides, and obtain it by pronuclear injection Macrophage-specific Noc4l overexpressing mouse (OE), preparation strategy see image 3 and Figure 4 .

[0035] Identify primers:

[0036] LKO mouse identification primers:

[0037] loxptF:GCCTTGTCATAGACCATGCGATCTG,

[0038] loxptR: TAAGATGCCA...

Embodiment 3

[0048] The inventors took 5 C57BL / 6 male mice (purchased from Speyford) about 8 weeks old, 5 NOC4L macrophage-specific knockout mice (LKO mice), and 5 NOC4L macrophage-specific overexpression mice (OE mice). 5 mice, with an average body weight of more than 20 grams, were added 2.5% dextran sulfate sodium (DSS) (USA MP company, product number 0216011080) to the drinking water, and the UC model was constructed by drinking freely for 5 days, and recorded every day Body weight, mortality, and blood in the stool were observed. On the 6th day of induction, they were replaced with ordinary drinking water without adding DSS. On the 8th day, the rats were killed and the tissues were collected. The length of the colorectum and spleen weight were recorded, and the pathological conditions were observed by HE staining.

[0049] After induction, the body weight of WT, LKO and OE mice all decreased, see Figure 5 , but the mortality rate of OE mice was significantly higher than that of WT an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses the application of an ulcerative colitis biological marker and treatment target spot. According to the application of the ulcerative colitis biological marker and treatment target spot, it is found that the expression amount of a NOC4L protein in a mouse is related to ulcerative colitis, and the NOC4L protein can be used as the biological marker of the ulcerative colitis. It is further found that symptoms of the ulcerative colitis of a macrophagespecific knock-out NO4L mouse are improved, and the survival rate is higher. A new target spot for researching a novel medicament for treating the ulcerative colitis is provided, a detection target is further provided for the diagnosis of the ulcerative colitis, and the application prospect is good.

Description

technical field [0001] The present invention relates to a biomarker, in particular to the application of NOC4L protein as a biomarker and therapeutic target of ulcerative colitis. Background technique [0002] Inflammatory bowel disease (IBD) is a group of chronic nonspecific intestinal inflammatory diseases of unknown etiology, mainly including ulcerative colitis (UC) and Crohn's disease (CD). The disease used to be more common in western countries, while the incidence rate in developing countries is relatively low. However, with the process of industrialization and urbanization in the past 20 years, the incidence rate of IBD in China has been increasing year by year, which has attracted the attention of clinical workers. Research on the disease has also continued to deepen. [0003] UC is a chronic non-specific inflammatory disease of the colon and rectum whose etiology is not yet clear, and the lesions are limited to the mucosa and submucosa of the large intestine. The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68A61K45/00A61K38/17A61P1/00A61P1/04
CPCG01N33/68A61K38/1745A61K45/00A61P1/00A61P1/04G01N2800/065
Inventor 李向东贾力娜任新敏
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap