Application of ulcerative colitis biological marker and treatment target spot
A technology for ulcerative colitis and biomarkers is applied in the application field of ulcerative colitis biomarkers and therapeutic targets, which can solve the problems of easy repetition, long drug treatment cycle, and easy generation of drug resistance, so as to improve the Survival rate, good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Take 30 C57BL / 6 male mice (purchased from Speyford) about 8 weeks old, with an average body weight of more than 20g, and set up a control group and an experimental group. The experimental group is drinking water with 2.5% dextran sulfate sodium (dextran sulfate sodium, DSS) (U.S. MP company, article number 0216011080), the UC model was constructed by mice drinking freely for 5 days, and the blood in the stool was observed, and the mice were killed on the 0th day, the 1st day, the 3rd day, and the 5th day of induction, and the tissues were taken. The RNA level expression detection of NOC4L, the results show that after DSS induction, the RNA expression level of NOC4L in the colon is up-regulated, see figure 2 .
Embodiment 2
[0034] The inventors have found that NOC4L is highly expressed in inflammatory cells, and it is speculated that NOC4L is related to inflammatory diseases. In order to further study the role of NOC4L in mice, NOC4L knockout and overexpression mice were prepared by Nanjing Model Animal Center. Add loxp sites to both ends of the mouse exon3, and mate with macrophage-specific knockout lyz-cre tool mice to obtain macrophage-specific knockout LKO mice. Insert the Noc4l gene of the mouse into the lyz promoter (an element used to specifically enhance the expression of myeloid genes), and insert the insulator (an element that plays a key role in regulating the specific expression of Noc4l) on both sides, and obtain it by pronuclear injection Macrophage-specific Noc4l overexpressing mouse (OE), preparation strategy see image 3 and Figure 4 .
[0035] Identify primers:
[0036] LKO mouse identification primers:
[0037] loxptF:GCCTTGTCATAGACCATGCGATCTG,
[0038] loxptR: TAAGATGCCA...
Embodiment 3
[0048] The inventors took 5 C57BL / 6 male mice (purchased from Speyford) about 8 weeks old, 5 NOC4L macrophage-specific knockout mice (LKO mice), and 5 NOC4L macrophage-specific overexpression mice (OE mice). 5 mice, with an average body weight of more than 20 grams, were added 2.5% dextran sulfate sodium (DSS) (USA MP company, product number 0216011080) to the drinking water, and the UC model was constructed by drinking freely for 5 days, and recorded every day Body weight, mortality, and blood in the stool were observed. On the 6th day of induction, they were replaced with ordinary drinking water without adding DSS. On the 8th day, the rats were killed and the tissues were collected. The length of the colorectum and spleen weight were recorded, and the pathological conditions were observed by HE staining.
[0049] After induction, the body weight of WT, LKO and OE mice all decreased, see Figure 5 , but the mortality rate of OE mice was significantly higher than that of WT an...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap