Unlock instant, AI-driven research and patent intelligence for your innovation.

Kits for Cancer Screening, Therapy, and Prognosis Using Noncoding RNAs

A non-coding, cancer technology, applied in the field of molecular biology, can solve problems such as short survival time and poor prognosis of patients

Active Publication Date: 2020-12-11
TSINGHUA UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The long-chain non-coding gene MALAT1 (Metastasis-Associated Lung Adenocarcinoma Transcript1, MALAT1) is one of them. MALAT1 initially attracted attention because of its high expression in lung cancer, and then other research groups found that it was abnormally expressed in a variety of malignant tumors , and patients with high expression of this lncRNA have poor prognosis and short survival

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kits for Cancer Screening, Therapy, and Prognosis Using Noncoding RNAs
  • Kits for Cancer Screening, Therapy, and Prognosis Using Noncoding RNAs
  • Kits for Cancer Screening, Therapy, and Prognosis Using Noncoding RNAs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0041] Example 1 The effect of knockdown of WN on the proliferation ability of breast cancer cells

[0042] WN, LINC00973, the position on the chromosome is: hg38chr3:98,981,058-98,983,096, the transcript number is ENST00000473756.1, there are two exons, the full length of the transcript is 962nt, and the full length sequence of the transcribed RNA is as follows:

[0043] Serial number SEQ ID NO:1:

[0044] agaagctcttgggagcatgtggacagttgtggctgctcctgagctgacactaactgctcatgactcctctgtgggagaagtaggtggtttcctagaggaagaagtttgggtaatgaagccacagagatttgctgatacatttgctaggcacgacttctggtcatttagaaagctattttgtggcttcatcaataaggtattccccagctgtgttactccttcgcattgttatctctttccctggaattgaaggcttcctggtctgaggcaaggacaattattccctcactgtcaaccctgatctctggctgcagtaatgagtagaggaaatgaagaaataagaatggaagcataatcatttgtccgaggtcacagagggagatgattacacagctggaatgtaagcctcagtactttactgaatccttggctttgtccatgggcccagctacaggcataaagcttttctcttccccagcagtgacttcgagtaccagctttcaaatttatttgacattgaatctaagctttgtgaccagtatgtagaaggagaagaaggggaggaattacttatcctttgg...

Embodiment 2

[0096] Example 2: The effect of knockdown of WN on the proliferation ability of lung cancer cells

[0097] The inventors found that WN is highly expressed not only in breast cancer, but also in various cancers, including lung cancer, so the inventors verified its phenotype in the human lung adenocarcinoma cell line A549. The inventors first verified whether the two shRNA sequences PLKO-WN2 and PLKO-WN5, which worked well in the breast cancer lung metastasis cell line LM2, could also have a good knockdown effect on A549. The detection method is the same as that in LM2, and the raw data of qPCR are shown in Table 8:

[0098] Table 8: Raw ct values ​​of WN knockdown in qPCR in A549 cells

[0099]

[0100]

[0101] according to Methods Data analysis was carried out, and Table 9 was obtained. It can be seen from the table that, compared with the cells transfected with the virus packaged by the negative plasmid PLKO-NC, the cells transfected with the virus packaged by the P...

Embodiment 3

[0108] Example 3 Interaction research between WN and LDHA in breast cancer cell line LM2

[0109] After verifying the effect of WN on cell proliferation, the inventors wanted to further explore the mechanism of WN. The experimental method used by the inventors is CHIRP. This technique was first used to explore the interaction between RNA and DNA, and later researchers found that this method can also be used to explore the interaction between RNA and protein. The principle is as follows: First, by synthesizing multiple probes targeting the complementary sequence of lncRNA, modifying them with biotin, and then hybridizing the probes with cross-linked and broken cell samples, using The probes with biotin-modified ends are captured by the magnetic beads of mycin, so that the protein bound by the target lncRNA is pulled out together. The processed samples are analyzed by the protein detection center for mass spectrometry, and the possible interactions with the target lncRNA can be...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for cancer detection, treatment and prognosis using non-coding RNA (ribonucleic acid). Non-coding RNA can be used as a marker for the cancer detection and prognosis and asa target for the cancer treatment.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a kit for detecting, treating and prognosing cancer by using non-coding RNA. Background technique [0002] With the rapid development of genome sequencing technology, it has been found that 70% of the genome sequence is transcribed into RNA, but only less than 2% of the sequence encodes protein, and the rest are called non-coding RNA. Long non-coding RNA (long non-coding RNA, lncRNA) refers to a type of RNA whose transcript length is greater than 200 nucleotides and does not have protein coding function. In the past, people thought that non-coding RNA was a "garbage product", but recent studies have found that long-chain non-coding RNA is involved in the regulation of many important life processes, including the occurrence and development of tumors. Long-chain non-coding RNA has primary sequence information and can interact with nucleic acid molecules through complemen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886A61K31/7105A61K48/00A61P35/00
Inventor 王会丽林克权王栋
Owner TSINGHUA UNIV