Kits for Cancer Screening, Therapy, and Prognosis Using Noncoding RNAs
A non-coding, cancer technology, applied in the field of molecular biology, can solve problems such as short survival time and poor prognosis of patients
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0041] Example 1 The effect of knockdown of WN on the proliferation ability of breast cancer cells
[0042] WN, LINC00973, the position on the chromosome is: hg38chr3:98,981,058-98,983,096, the transcript number is ENST00000473756.1, there are two exons, the full length of the transcript is 962nt, and the full length sequence of the transcribed RNA is as follows:
[0043] Serial number SEQ ID NO:1:
[0044] agaagctcttgggagcatgtggacagttgtggctgctcctgagctgacactaactgctcatgactcctctgtgggagaagtaggtggtttcctagaggaagaagtttgggtaatgaagccacagagatttgctgatacatttgctaggcacgacttctggtcatttagaaagctattttgtggcttcatcaataaggtattccccagctgtgttactccttcgcattgttatctctttccctggaattgaaggcttcctggtctgaggcaaggacaattattccctcactgtcaaccctgatctctggctgcagtaatgagtagaggaaatgaagaaataagaatggaagcataatcatttgtccgaggtcacagagggagatgattacacagctggaatgtaagcctcagtactttactgaatccttggctttgtccatgggcccagctacaggcataaagcttttctcttccccagcagtgacttcgagtaccagctttcaaatttatttgacattgaatctaagctttgtgaccagtatgtagaaggagaagaaggggaggaattacttatcctttgg...
Embodiment 2
[0096] Example 2: The effect of knockdown of WN on the proliferation ability of lung cancer cells
[0097] The inventors found that WN is highly expressed not only in breast cancer, but also in various cancers, including lung cancer, so the inventors verified its phenotype in the human lung adenocarcinoma cell line A549. The inventors first verified whether the two shRNA sequences PLKO-WN2 and PLKO-WN5, which worked well in the breast cancer lung metastasis cell line LM2, could also have a good knockdown effect on A549. The detection method is the same as that in LM2, and the raw data of qPCR are shown in Table 8:
[0098] Table 8: Raw ct values of WN knockdown in qPCR in A549 cells
[0099]
[0100]
[0101] according to Methods Data analysis was carried out, and Table 9 was obtained. It can be seen from the table that, compared with the cells transfected with the virus packaged by the negative plasmid PLKO-NC, the cells transfected with the virus packaged by the P...
Embodiment 3
[0108] Example 3 Interaction research between WN and LDHA in breast cancer cell line LM2
[0109] After verifying the effect of WN on cell proliferation, the inventors wanted to further explore the mechanism of WN. The experimental method used by the inventors is CHIRP. This technique was first used to explore the interaction between RNA and DNA, and later researchers found that this method can also be used to explore the interaction between RNA and protein. The principle is as follows: First, by synthesizing multiple probes targeting the complementary sequence of lncRNA, modifying them with biotin, and then hybridizing the probes with cross-linked and broken cell samples, using The probes with biotin-modified ends are captured by the magnetic beads of mycin, so that the protein bound by the target lncRNA is pulled out together. The processed samples are analyzed by the protein detection center for mass spectrometry, and the possible interactions with the target lncRNA can be...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


