Supercharge Your Innovation With Domain-Expert AI Agents!

Migratory locust serine protease inhibitor 7 and its coding gene and application

A technology of serine protease and encoding gene, applied in locust serine protease inhibitor 7 and its encoding gene and application field

Active Publication Date: 2021-10-08
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, little research has been reported on the effect of serpin on diapause

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Migratory locust serine protease inhibitor 7 and its coding gene and application
  • Migratory locust serine protease inhibitor 7 and its coding gene and application
  • Migratory locust serine protease inhibitor 7 and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Embodiment 1, acquisition of migratory locust serine protease inhibitor 7 and its coding gene LmSerpin7

[0066] 1. Discovery of the LmSerpin7 gene

[0067] Through transcriptome analysis of diapause eggs and non-diapause eggs of migratory locusts, seven non-redundant serpin genes of migratory locusts were obtained, named Lmserpin1-Lmserpin7 respectively. Further label-free proteome sequencing was performed on diapause eggs and non-diapause eggs of migratory locust, and it was found that the expression of Lmserpin7 was significantly different in diapause eggs and non-diapause eggs.

[0068] 2. Acquisition of migratory locust serine protease inhibitor 7 and its coding gene LmSerpin7

[0069] 1. Extraction of total RNA from migratory locusts

[0070] use RNA isolation reagents were used to extract RNA from migratory locust tissue samples. Specific steps are as follows:

[0071] 1) Put a 2mL homogenizer in an oven at 160°C for 3 hours, then cool to room temperature f...

Embodiment 2

[0109] The dsRNA of embodiment 2, LmSerpin7 gene and its application in the control migratory locust

[0110] 1. Synthesis of dsRNA

[0111] Using T7 RiboMAX TM The Express RNAi System Kit synthesizes dsRNA. Specific steps are as follows:

[0112] 1. Synthesis of dsRNA primers

[0113] Primers were designed according to the cloned gene fragments, the target fragment was amplified to 602 bp, and T7 promoter was introduced at the 5' end of the primers. The primer sequences are as follows:

[0114] Serpin7-2F: TAATACGACTCACTATAGGCTGCTCAGGAGATTGTAGAGG;

[0115] Serpin7-2R: TAATACGACTCACTATAGGGACCATCATTCTTCTTTGGC.

[0116] 2. Preparation of DNA template

[0117] The bacterial liquid plasmid was extracted with a kit, and the plasmid containing the gene fragment (recombinant vector in Example 1) was used as a template, and Serpin7-2F and Serpin7-2R were used for PCR amplification to obtain the target fragment containing the T7 promoter sequence.

[0118] The PCR reaction sys...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses migratory locust serine protease inhibitor 7, its coding gene and application. The present invention clones the LmSerpin7 gene of migratory locusts from migratory locusts by gene cloning technology, and synthesizes the dsRNA used to interfere with the migratory locust LmSerpin7 gene, and uses the injection method to introduce the dsRNA into migratory locusts to perform RNAi on the migratory locust LmSerpin7 gene. As a result, it is found that the The gene can regulate the diapause of migratory locust eggs, and the invention provides a theoretical basis for a deeper understanding of the diapause mechanism of migratory locusts and the provision of new biological pesticide target sites.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to migratory locust serine protease inhibitor 7 (Serpin7) and its coding gene and application. Background technique [0002] Migratory locust is a major pest in agriculture and animal husbandry. It survives the winter with embryo diapause. It is a facultative diapause insect. The external conditions for diapause induction include temperature and photoperiod. The mechanisms of diapause regulation that have been reported so far include molecular regulation, hormone regulation, circadian clock regulation, and energy regulation, among which hormone regulation is generally accepted. [0003] The serine protease inhibitor (serpins) protein family is a protease inhibitor family with numerous members and widespread distribution. A typical serpin usually has 350-400 amino acids, and irreversible inhibition occurs when the serpin binds to a substrate. Studies have shown that serpins...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/81C12N15/15A01N57/16A01P7/04
Inventor 涂雄兵张泽华崔栋楠郝昆陈俊王广军农向群
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More