Migratory locust serine protease inhibitor 7 and coding gene and application thereof
A technology of serine protease and coding gene, applied in migratory locust serine protease inhibitor 7 and its coding gene and application field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Embodiment 1, acquisition of migratory locust serine protease inhibitor 7 and its coding gene LmSerpin7
[0066] 1. Discovery of the LmSerpin7 gene
[0067] Through transcriptome analysis of diapause eggs and non-diapause eggs of migratory locusts, seven non-redundant serpin genes of migratory locusts were obtained, named Lmserpin1-Lmserpin7 respectively. Further label-free proteome sequencing was performed on diapause eggs and non-diapause eggs of migratory locust, and it was found that the expression of Lmserpin7 was significantly different in diapause eggs and non-diapause eggs.
[0068] 2. Acquisition of migratory locust serine protease inhibitor 7 and its coding gene LmSerpin7
[0069] 1. Extraction of total RNA from migratory locusts
[0070] use RNA isolation reagents were used to extract RNA from migratory locust tissue samples. Specific steps are as follows:
[0071] 1) Put a 2mL homogenizer in an oven at 160°C for 3 hours, then cool to room temperature f...
Embodiment 2
[0109] The dsRNA of embodiment 2, LmSerpin7 gene and its application in the control migratory locust
[0110] 1. Synthesis of dsRNA
[0111] Using T7 RiboMAX TM The Express RNAi System Kit synthesizes dsRNA. Specific steps are as follows:
[0112] 1. Synthesis of dsRNA primers
[0113] Primers were designed according to the cloned gene fragments, the target fragment was amplified to 602 bp, and T7 promoter was introduced at the 5' end of the primers. The primer sequences are as follows:
[0114] Serpin7-2F: TAATACGACTCACTATAGGCTGCTCAGGAGATTGTAGAGG;
[0115] Serpin7-2R: TAATACGACTCACTATAGGGACCATCATTCTTCTTTGGC.
[0116] 2. Preparation of DNA template
[0117] The bacterial liquid plasmid was extracted with a kit, and the plasmid containing the gene fragment (recombinant vector in Example 1) was used as a template, and Serpin7-2F and Serpin7-2R were used for PCR amplification to obtain the target fragment containing the T7 promoter sequence.
[0118] The PCR reaction sys...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap