Primer and method for rapidly detecting methylation level of wheat photoperiod gene Ppd-B1 and applications thereof
A ppd-b1 and photoperiod technology, applied in the field of molecular biotechnology and breeding, can solve the problem of high reaction cost, achieve accurate identification results, reduce reaction cost, save reaction cost and reaction time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Establishment of a method for rapidly detecting the methylation level of wheat photoperiod gene Ppd-B1:
[0031] (1) The position and sequence of primers labeled by Ppd-B1 methylation molecule:
[0032] According to the Ppd-B1 methylation difference region, select the region (-1250~-665) containing the methylation-sensitive restriction endonuclease HpaII or BstUI recognition site (CCGG or CGCG), and design molecular marker primers and target fragments The length is 586bp (its nucleotide sequence is shown in SEQ ID NO. 3). When detecting the methylation type of the target material, first cut the DNA of the material to be tested with HpaII or BstUI, and the digested product is amplified with the newly developed label. The methylation type of Ppd-B1 can be quickly detected according to the presence or absence of the target fragment.
[0033] The primer names and sequences are as follows:
[0034] Ppd-B1-HpaII-F1: GGGGCCTTAAGATCGCCGATG
[0035] Ppd-B1-HpaII-R1: CGTGGACGA...
Embodiment 2
[0054] Example 2 Identification result example:
[0055] Five representative materials with reported methylation levels were detected by the molecular markers and bisulfite sequencing methods developed in the present invention: Am3 (No. 1, hypomethylation), Laizhou 953 (No. 2, hypomethylation), China Spring (No. 3, hypermethylation), Lumai 14 (No. 4, hypermethylation) and Yanzhan No. 1 (No. 5, hypermethylation). The technical appraisal results of the present invention are as follows figure 1 As shown in the figure, it can be seen that after BstUI and HpaⅡ digestion and PCR amplification of No. 1 and No. 2 materials, there is no band compared with the control group, while No. 3, No. 4 and No. 5 materials are compared with the control group. There are stripes. Utilize the bisulfite sequencing method to utilize the reported detection method (Sun H, Guo Z, Gao L, Zhao G, Zhang W, Zhou R, Wu Y, Wang H, An H, Jia J. DNA methylation pattern of Photoperiod-B1 is associated with photop...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


