Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer and method for rapidly detecting methylation level of wheat photoperiod gene Ppd-B1 and applications thereof

A ppd-b1 and photoperiod technology, applied in the field of molecular biotechnology and breeding, can solve the problem of high reaction cost, achieve accurate identification results, reduce reaction cost, save reaction cost and reaction time

Inactive Publication Date: 2019-06-28
LUDONG UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since this method also includes the step of converting genomic DNA with bisulfite, the reaction cost is still relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for rapidly detecting methylation level of wheat photoperiod gene Ppd-B1 and applications thereof
  • Primer and method for rapidly detecting methylation level of wheat photoperiod gene Ppd-B1 and applications thereof
  • Primer and method for rapidly detecting methylation level of wheat photoperiod gene Ppd-B1 and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Establishment of a method for rapidly detecting the methylation level of wheat photoperiod gene Ppd-B1:

[0031] (1) The position and sequence of primers labeled by Ppd-B1 methylation molecule:

[0032] According to the Ppd-B1 methylation difference region, select the region (-1250~-665) containing the methylation-sensitive restriction endonuclease HpaII or BstUI recognition site (CCGG or CGCG), and design molecular marker primers and target fragments The length is 586bp (its nucleotide sequence is shown in SEQ ID NO. 3). When detecting the methylation type of the target material, first cut the DNA of the material to be tested with HpaII or BstUI, and the digested product is amplified with the newly developed label. The methylation type of Ppd-B1 can be quickly detected according to the presence or absence of the target fragment.

[0033] The primer names and sequences are as follows:

[0034] Ppd-B1-HpaII-F1: GGGGCCTTAAGATCGCCGATG

[0035] Ppd-B1-HpaII-R1: CGTGGACGA...

Embodiment 2

[0054] Example 2 Identification result example:

[0055] Five representative materials with reported methylation levels were detected by the molecular markers and bisulfite sequencing methods developed in the present invention: Am3 (No. 1, hypomethylation), Laizhou 953 (No. 2, hypomethylation), China Spring (No. 3, hypermethylation), Lumai 14 (No. 4, hypermethylation) and Yanzhan No. 1 (No. 5, hypermethylation). The technical appraisal results of the present invention are as follows figure 1 As shown in the figure, it can be seen that after BstUI and HpaⅡ digestion and PCR amplification of No. 1 and No. 2 materials, there is no band compared with the control group, while No. 3, No. 4 and No. 5 materials are compared with the control group. There are stripes. Utilize the bisulfite sequencing method to utilize the reported detection method (Sun H, Guo Z, Gao L, Zhao G, Zhang W, Zhou R, Wu Y, Wang H, An H, Jia J. DNA methylation pattern of Photoperiod-B1 is associated with photop...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and method for rapidly detecting a methylation level of a wheat photoperiod gene Ppd-B1 and applications thereof. The primer comprises Ppd-B1-HpaII-F1 and Ppd-B1-HpaII-R1, and nucleotide sequences of the primer are respectively as shown in SEQ ID NO. 1 and SEQ ID NO. 2. The method comprises the following steps: extracting wheat material genome DNA by a CTAB method;carrying out enzyme digestion treatment on the wheat material genome DNA; carrying out PCR amplification treatment on a product after the enzyme digestion treatment; detecting an amplified product by1.5% agarose gel electrophoresis, if an amplified fragment with a molecular weight of 586 bp is obtained, indicating that identified material is of a Ppd-B1 hypermethylation type, otherwise indicating that the identified material is of a Ppd-B1 hypomethylation type. The method not only has accurate result, but also greatly reduces reaction cost and reaction time.

Description

Technical field [0001] The invention belongs to the field of molecular biotechnology and breeding applications, and specifically relates to a primer, method and application for quickly detecting the methylation level of wheat photoperiod gene Ppd-B1. Background technique [0002] Wheat (Triticum aestivum L.) is an important food crop, and cultivating high-yield and high-quality wheat varieties is of great significance to solving global food problems. In the "green revolution" of wheat, the ability to adapt to a wide range of regions determined by photoperiod insensitivity is an important feature of high-yield wheat. In-depth research on the mechanism of controlling the formation of photoperiod insensitive sites in wheat, the development of simple and effective molecular markers and their application in production practices are of great significance for improving the adaptability of wheat to the environment and expanding the scope of introduction. [0003] Wheat has three main gene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
Inventor 孙晗吴永振崔法赵春华余梦伟黄世霞陈易安
Owner LUDONG UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More