Method for constructing suicide plasmid and drug-resistant mutant strain based on mariner transposon

A drug-resistant mutation and suicide-type technology, applied in the field of genetic engineering, can solve problems such as poor results, high requirements for technicians, and high cost of sequencing technology, and achieve high cost, reduced labor intensity, and heavy workload.

Active Publication Date: 2020-07-31
SOUTH CHINA AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, sequencing technology is expensive. Sequencing technology can be used to compare the homology of gene sequences, but for the study of some subtypes with relatively large differences, the effect is not good, and the requirements for technical personnel are very high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing suicide plasmid and drug-resistant mutant strain based on mariner transposon
  • Method for constructing suicide plasmid and drug-resistant mutant strain based on mariner transposon
  • Method for constructing suicide plasmid and drug-resistant mutant strain based on mariner transposon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1: Screening of new genes resistant to carbapenems antibiotics based on mariner transposition mutation technology

[0073] 1. Construction of mutant strains

[0074] (1) Construction of pTPM-XY plasmid: The structure diagram of pTPM-XY plasmid is as follows figure 1 As shown, pTPM-XY plasmid consists of replicon R6k, mariner transposon, tpm R and Amp R The resistance gene and Traj are responsible for the gene composition of conjugative transfer, and its construction process is as follows:

[0075] Using the pCat-marinerr plasmid (purchased from Shanghai Jikai Gene Technology Co., Ltd.) as the parent (template), PCR amplification was carried out with primers at-F and CatR (at-F: ccagaactcatgttgcatggtat; CatR: ccaagttctgaGCCTTTTTG CG) to obtain a 3443bp amplified Amplify the product (as a plasmid backbone); then use the pUC57-tpm plasmid containing the tpm gene synthesized by Qingke Biotechnology Co., Ltd. as a template, and use primers TP M-F and TPM-R (TPM-F:...

Embodiment 2

[0126] Example 2 Construction of Mutant Library Based on Mariner Mutation Technology

[0127] In order to study whether this mutation technique can be used to construct mutation libraries of other bacterial strains, four strains of standard bacteria were selected in this embodiment: Enterobacter cloacae ATCC13047, Salmonella ATCC14028, Klebsiella pneumoniae ATCC700603, and Escherichia coli C600 (E.coli C600), All of the above were purchased from Guangzhou Chengkang Biotechnology Co., Ltd.

[0128] 1. Determination of sensitivity of experimental strains to tellurite

[0129] Streak inoculate the experimental strain on MacConkey agar medium (purchased from Guangzhou Huankai Biotechnology Co., Ltd.) for culture, and take a single colony to subculture on the next day and culture it on LB agar containing 25 μg / ml sodium tellurite (purchased from Guangzhou Huankai Biotechnology Co., Ltd.), it was found that no colonies grew on the agar plate, which proved that the above strains wer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for building suicidal plasmids and drug-resistant mutant strains based on mariner transposons. The building of the suicidal plasmids comprises the following steps of performing PCR amplification by using pCat-marinerr plasmids as templates; using an obtained amplification product as a plasmid framework; then, amplifying tpm resistant genes by using pUC57-tpm plasmids as templates; then, performing homologous recombination on the plasmid framework and the tpm resistant genes to obtain the suicidal plasmids. The drug-resistant mutant strains are obtained by converting the suicidal plasmids into bacillus coli WM3064 competent cells; then, performing mixed culture on obtained strains and target strains; next, performing screening by using a single drug plate containing tellurite and a double drug plate containing tellurite and original resistance screening labelling drugs. The method has the advantages that the operation is simple; a transposon mutant strain can be obtained at high flux; the method is applicable to the building of drug-resistant strains or screening drugs.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a method for constructing suicide plasmids and drug-resistant mutant strains based on mariner transposons. Background technique [0002] The emergence of bacterial resistance to antibiotics has become a concern, with drug-resistant bacteria increasingly appearing in animals and, increasingly, in humans around the world. Some bacteria are resistant to almost all clinical drugs, mainly because bacteria acquire certain drug-resistant genes through horizontal or vertical transmission or their own gene mutations. For example, the gene-encoded anti-broad-spectrum cephalosporin makes bacteria resistant to carbapenems, the gene-encoded 16s rRNA methylase endows bacteria with the ability to resist aminoglycosides, and the plasmid-mediated quinolone resistance (PMQR) gene endows bacteria with resistance to carbapenems. Bacterial resistance to fluoroquinolones. The mcr gene co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/63C12N15/65C12N1/21C12R1/19C12R1/01C12R1/22C12R1/42
CPCC12N15/63C12N15/65C12N2800/90
Inventor孙坚李龚何玉张刁晓苑于泳鑫刘雅红廖晓萍
OwnerSOUTH CHINA AGRI UNIV