Unlock instant, AI-driven research and patent intelligence for your innovation.

A Combination of Anti-Vibrio Molecular Markers in Shrimp and Its Application in Breeding

A technology of molecular markers and prawns, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problems of low accuracy rate and poor effect of breeding, and achieve simple operation, high accuracy rate, Effects that speed up breeding progress

Active Publication Date: 2022-05-06
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for resistance traits, traditional breeding methods have low accuracy and poor results. With the development of molecular marker technology, more and more resistance-related molecular markers have been discovered. Using molecular markers or resistance genes Marking or gene-assisted breeding of resistant varieties has the advantages of high breeding accuracy, good breeding effect, and not affected by the environment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Combination of Anti-Vibrio Molecular Markers in Shrimp and Its Application in Breeding
  • A Combination of Anti-Vibrio Molecular Markers in Shrimp and Its Application in Breeding
  • A Combination of Anti-Vibrio Molecular Markers in Shrimp and Its Application in Breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: Acquisition of molecular markers related to anti-vibrio in prawns

[0020] (1) Shrimp material and Vibrio infection test

[0021] The material used for the Vibrio test was Litopenaeus vannamei "Guangtai No. 1", which was obtained from Hainan Guangshun Taipu Marine Breeding Co., Ltd. sky. The Vibrio parahaemolyticus used for Vibrio infection was obtained from shrimps that died of acute hepatopancreatic necrosis, and the Vibrio parahaemolyticus was expanded in TSB medium with a concentration of 2.0% sodium chloride, and then PCR primer VpPirA-284F was used: TGACTATTCTCACGATTGGACTG and VpPirA-284R: Detection of PirA by CACGACTAGCGCCATTGTTA vp , and using VpPirB-392F: TGATGAAGTGATGGGTGCTC and VpPirB-392R: TGTAAGCGCCGTTTAACTCA to detect PirB vp Toxic plasmid, the injection dose of each shrimp is 2.5×104CFU / g. At the same time, two batches of materials were selected as repetitions. The first batch of materials contained 236 shrimps, the second batch of material...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of aquatic animal disease-resistant breeding, and in particular relates to a prawn anti-vibrio molecular marker combination and its application in breeding. The present invention discloses a group of SNP marker combinations related to shrimp resistance to Vibrio, including 12 resistance-related SNP markers, which have the sequence shown in SEQ ID NO.1-12. Using these resistance SNP markers, the present invention discloses A method for molecular marker-assisted breeding of anti-vibrio shrimp. Compared with traditional breeding, the method has higher accuracy and can significantly speed up the progress of genetic selection. It is of great significance for cultivating new anti-vibrio varieties and improving the survival rate of shrimp farming.

Description

technical field [0001] The invention belongs to the field of aquatic animal disease-resistant breeding, and in particular relates to a prawn anti-vibrio molecular marker combination and its application in breeding. Background technique [0002] Shrimp farming occupies an important position in my country's aquaculture, with an annual output of 1.6 million tons of prawns at the peak, of which Litopenaeus vannamei (Litopenaeus vannamei) dominates. This species is native to Central and South America, and was introduced into my country in the 1980s. After nearly 30 years of development, it has become the most important shrimp farming species in my country and even in the world. However, in recent years, due to disease problems, the production has been reduced on a large scale. One of the important diseases is acute hepatopancreatic necrosis syndrome, and the report shows that the main pathogen of this disease is Vibrio parahaemolyticus. [0003] There is currently no effective c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 于洋李富花张倩相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI