A Combination of Anti-Vibrio Molecular Markers in Shrimp and Its Application in Breeding
A technology of molecular markers and prawns, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problems of low accuracy rate and poor effect of breeding, and achieve simple operation, high accuracy rate, Effects that speed up breeding progress
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1: Acquisition of molecular markers related to anti-vibrio in prawns
[0020] (1) Shrimp material and Vibrio infection test
[0021] The material used for the Vibrio test was Litopenaeus vannamei "Guangtai No. 1", which was obtained from Hainan Guangshun Taipu Marine Breeding Co., Ltd. sky. The Vibrio parahaemolyticus used for Vibrio infection was obtained from shrimps that died of acute hepatopancreatic necrosis, and the Vibrio parahaemolyticus was expanded in TSB medium with a concentration of 2.0% sodium chloride, and then PCR primer VpPirA-284F was used: TGACTATTCTCACGATTGGACTG and VpPirA-284R: Detection of PirA by CACGACTAGCGCCATTGTTA vp , and using VpPirB-392F: TGATGAAGTGATGGGTGCTC and VpPirB-392R: TGTAAGCGCCGTTTAACTCA to detect PirB vp Toxic plasmid, the injection dose of each shrimp is 2.5×104CFU / g. At the same time, two batches of materials were selected as repetitions. The first batch of materials contained 236 shrimps, the second batch of material...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


