A molecular marker snpa9-5 associated with rapeseed thousand-grain weight and its application
A thousand-grain weight, rapeseed technology, applied in the fields of molecular biology and genetic breeding, can solve problems such as small repeatability, high cost, and threat to supply security, and achieve the effects of accelerating the breeding process, reducing workload, and shortening the breeding cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Acquisition of SNP markers significantly associated with rapeseed thousand-grain weight:
[0024] (1) Collect 331 inbred lines of Brassica napus from various countries in the world as the core related population of rapeseed, collect individual leaves of each line of the related population, extract the total DNA by CTAB method, and use the rapeseed 60K SNP chip to analyze each sample Perform genotype analysis.
[0025](2) Use the Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each locus Gene frequency (minor allele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique match of the SNP marker in the Brassica napus genome were used as the screening criteria to filter the SNP markers, and finally 24,508 high-quality SNP markers were obtained for the w...
Embodiment 2
[0029] Acquisition of a molecular marker primer significantly associated with thousand-grain weight:
[0030] (1) Extract the sequence of 100 bp upstream and downstream of the 28th, 260, and 725th base of rape A09 chromosome. According to the primer design principle, develop the SNP marker primer snpA9-5, the forward primer is snpA9-5F: ATGGGATTCACAAGTTTTACCAAA, and the reverse primer is snpA9-5R: GCTTGGTGTTGTGTTTCTCTGA, the amplicon size is 82bp.
[0031] The sequence amplified in Brassica napus small-grain material Tapidor (the average thousand-grain weight is 2.86g) is the GG genotype, and the sequence is as follows:
[0032] GCTTGGTGTTGTGTTTCCTGATTTCTCTGTTTGAAGCCCTGATTTAGTTTCTACCAATTTGGTAAAACTTGTGAATCCCAT
[0033] The sequence amplified in Brassica napus large-grain material No.93237 (the average thousand-grain weight is 5.72g) is the AA genotype, and the sequence is as follows:
[0034] GCTTGGTGTTGTGTTTCTCTGATTTCTCTGTTTGAAGCCCTAATTTAGTTTCTACCAATTTGGTAAAACTTGTGAATCCCAT ...
Embodiment 3
[0037] The application of primers designed based on the 28,260,725th base of rapeseed A09 chromosome in rapeseed thousand-grain weight screening and breeding, the steps are as follows:
[0038] (1) Among the 331 materials, 20 materials with small thousand-grain weight (Li et al., 2014) and 19 materials with large thousand-grain weight (Li et al., 2014) were selected after multiple generations of self-crossing.
[0039] (2) The distribution of the two genotypes of snpA9-5, a molecular marker significantly associated with thousand-grain weight, in 20 materials with small thousand-grain weight and 19 materials with large thousand-grain weight were examined. The results showed that the genotype of molecular marker S42 was GG genotype in 13 of the 20 small thousand-grain weight materials, but only 3 of the 1000-grain weight materials were GG genotype and 14 were AA (Table 1).
[0040] In addition, among the 331 related populations, 177 materials were of genotype AA detected by mol...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com