Unlock instant, AI-driven research and patent intelligence for your innovation.

A molecular marker snpa9-5 associated with rapeseed thousand-grain weight and its application

A thousand-grain weight, rapeseed technology, applied in the fields of molecular biology and genetic breeding, can solve problems such as small repeatability, high cost, and threat to supply security, and achieve the effects of accelerating the breeding process, reducing workload, and shortening the breeding cycle

Active Publication Date: 2022-03-15
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the self-sufficiency rate of domestic vegetable oil in my country is less than 35%, which seriously threatens its supply security.
However, AFLP markers also have some disadvantages: high cost, complex process, and technical difficulty; most of the markers are dominant markers; there are high requirements for DNA quality and restriction endonuclease quality
There are also some reports on QTL mapping of rapeseed thousand-grain weight (Quijada et al., 2006; Udall et al., 2006; Radoev et al., 2008; Shi et al., 2009; Wang Feng et al., 2010; Basunanda et al., 2010; Fan et al., 2010; Zhang et al., 2011; Zhao Weiguo et al., 2017), but usually the detected QTL effect value is small and the repeatability is not good, so it is difficult to apply in rapeseed breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker snpa9-5 associated with rapeseed thousand-grain weight and its application
  • A molecular marker snpa9-5 associated with rapeseed thousand-grain weight and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Acquisition of SNP markers significantly associated with rapeseed thousand-grain weight:

[0024] (1) Collect 331 inbred lines of Brassica napus from various countries in the world as the core related population of rapeseed, collect individual leaves of each line of the related population, extract the total DNA by CTAB method, and use the rapeseed 60K SNP chip to analyze each sample Perform genotype analysis.

[0025](2) Use the Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each locus Gene frequency (minor allele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique match of the SNP marker in the Brassica napus genome were used as the screening criteria to filter the SNP markers, and finally 24,508 high-quality SNP markers were obtained for the w...

Embodiment 2

[0029] Acquisition of a molecular marker primer significantly associated with thousand-grain weight:

[0030] (1) Extract the sequence of 100 bp upstream and downstream of the 28th, 260, and 725th base of rape A09 chromosome. According to the primer design principle, develop the SNP marker primer snpA9-5, the forward primer is snpA9-5F: ATGGGATTCACAAGTTTTACCAAA, and the reverse primer is snpA9-5R: GCTTGGTGTTGTGTTTCTCTGA, the amplicon size is 82bp.

[0031] The sequence amplified in Brassica napus small-grain material Tapidor (the average thousand-grain weight is 2.86g) is the GG genotype, and the sequence is as follows:

[0032] GCTTGGTGTTGTGTTTCCTGATTTCTCTGTTTGAAGCCCTGATTTAGTTTCTACCAATTTGGTAAAACTTGTGAATCCCAT

[0033] The sequence amplified in Brassica napus large-grain material No.93237 (the average thousand-grain weight is 5.72g) is the AA genotype, and the sequence is as follows:

[0034] GCTTGGTGTTGTGTTTCTCTGATTTCTCTGTTTGAAGCCCTAATTTAGTTTCTACCAATTTGGTAAAACTTGTGAATCCCAT ...

Embodiment 3

[0037] The application of primers designed based on the 28,260,725th base of rapeseed A09 chromosome in rapeseed thousand-grain weight screening and breeding, the steps are as follows:

[0038] (1) Among the 331 materials, 20 materials with small thousand-grain weight (Li et al., 2014) and 19 materials with large thousand-grain weight (Li et al., 2014) were selected after multiple generations of self-crossing.

[0039] (2) The distribution of the two genotypes of snpA9-5, a molecular marker significantly associated with thousand-grain weight, in 20 materials with small thousand-grain weight and 19 materials with large thousand-grain weight were examined. The results showed that the genotype of molecular marker S42 was GG genotype in 13 of the 20 small thousand-grain weight materials, but only 3 of the 1000-grain weight materials were GG genotype and 14 were AA (Table 1).

[0040] In addition, among the 331 related populations, 177 materials were of genotype AA detected by mol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker SNPA9‑5 associated with rapeseed thousand-grain weight and its application. The present invention obtains a SNP (single nucleotide polymorphism) marker significantly associated with rapeseed thousand-grain weight, located at base 28,260,725 of rapeseed A09 chromosome, which can explain an average of 6.1% of the phenotypic variation, with an average additive effect of 0.18 . The primers designed according to the molecular markers were snpA9‑5F: ATGGGATTCACAAGTTTTACCAAA, snpA9‑5R: GCTTGGTGTTGTGTTTCTCTGA. By checking the molecular marker snpA9‑5, which is significantly associated with the thousand-grain weight of rapeseed, the size of the thousand-grain weight of rapeseed can be predicted, and then the excellent individual plants with larger thousand-grain weight can be quickly and accurately screened.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a molecular marker significantly related to the thousand-grain weight of Brassica napus and its application. Background technique [0002] Rapeseed oil is the largest source of domestic edible vegetable oil, accounting for more than 55% of my country's total vegetable oil production (Wang Hanzhong, 2018). However, the self-sufficiency rate of domestic vegetable oil in my country is less than 35%, which seriously threatens its supply security. In order to ensure the effective supply of domestic vegetable oil in our country, in the case of sluggish planting area growth, the only way out is to continuously increase the oil production per unit area (=unit yield×oil content). In recent years, my country's rapeseed high-oil content breeding has made a breakthrough (Fu Tingdong, 2014), but the yield per unit area is still lower than the world a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 王汉中宋东霁师家勤王新发刘贵华詹杰鹏
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI