Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker BnZn-3A1 closely linked with rape zinc content character QTL and application of molecular marker BnZn-3A1

A technology of bnzn-3a1-f2, zinc content, applied in the fields of molecular biology and genetic breeding, can solve the problems of long breeding cycle, difficult breeding improvement, low selection efficiency, etc., to speed up the breeding process, shorten the breeding cycle, reduce the The effect of workload

Pending Publication Date: 2022-08-05
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] It is difficult to improve the crop breeding and improvement of trace elements such as zinc by applying traditional breeding technology, and there are defects such as low selection efficiency and long breeding cycle.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker BnZn-3A1 closely linked with rape zinc content character QTL and application of molecular marker BnZn-3A1
  • Molecular marker BnZn-3A1 closely linked with rape zinc content character QTL and application of molecular marker BnZn-3A1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Obtainment of the main QTL locus qBnZn-3A1 for the zinc content trait in rapeseed:

[0029] (1) Collect 327 inbred lines of Brassica napus from various countries in the world as the related group of rape The rapeseed 50K Illumina SNP chip developed by the company performs genotype analysis on each sample.

[0030] (2) Use Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate), and least allele of the population material at each locus Gene frequency (minor allele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique matching of the SNP marker in the Brassica napus Darmor genome (Chalhoub et al., 2014) were used as the screening criteria to filter the SNP markers, and finally obtained 21,243 high-quality SNP markers for genome-wide association analysis.

[0031] (3) The genotype data of the obtained ass...

Embodiment 2

[0035] Obtaining of a molecular marker primer closely linked to the QTL locus qBnZn-3A1 for the trait of zinc content in rapeseed:

[0036] (1) Extract the sequence of 100 bp upstream and downstream of the 9886351st base of the Brassica napus chromosome A03, according to the KASP (Kompetitive Allele-Specific PCR, that is, competitive allele-specific PCR) molecular marker primer design principle, for its sense strand , developed the KASP molecular marker BnZn-3A1, which includes two competitive forward primers BnZn-3A1-F1 and BnZn-3A1-F2, corresponding to the sequence bases A and G of the above SNP variation sites, and a reverse Universal primer BnZn-3A1-R, the primer sequence is as follows:

[0037] BnZn-3A1-F1: gtggggccaactaatctgtga

[0038] BnZn-3A1-F2: tggggccaactaatctgtgg

[0039] BnZn-3A1-R: ccaccggagatttatatgatcgt

[0040] The above primers should be based on the principle of KASP marker development, and a KASP marker universal linker should be added before use.

[0...

Embodiment 3

[0047] The application of primers designed based on the 9886351st base of rape A03 chromosome in the screening and breeding of rapeseed zinc content traits, the steps are as follows:

[0048] (1) Among the 327 materials, 25 materials with higher zinc content and 25 materials with lower zinc content that have been homozygous after multiple generations of self-breeding were selected, and the rapeseed hydroponic nutrition system containing 0.22 mg / L zinc element was used to cultivate it to the five-leaf stage. , Determination of zinc content in vegetable seedlings by flame atomic absorption spectrometry.

[0049] (2) To examine the distribution of the two genotypes of the molecular marker BnZn-3A1 in the above-mentioned materials with high and low zinc content. The results showed that the genotype of molecular marker BnZn-3A1 was A in 11 and B in 14 of the 25 materials with high zinc content, while 17 of the 25 materials with low zinc content were A and 8 were B. B (Table 1).

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker BnZn-3A1 closely linked with a rape zinc content character QTL and application of the molecular marker BnZn-3A1. According to the invention, an SNP (Single Nucleotide Polymorphism) marker which is obviously associated with the zinc content of the rape is obtained, is positioned at the 9886351th basic group position on the A03 chromosome of a Darma-bzh v10 genome, and can explain 5.3% of phenotypic variation. The molecular marker is used for auxiliary selection, so that the screening efficiency of the rape single plant with higher zinc element can be improved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, in particular to a molecular marker BnZn-3A1 closely linked with the QTL of rape zinc content trait and its application. Background technique [0002] As the second most abundant trace element in the human body, zinc is closely related to the normal structure and function of many functional proteins and biofilms. Deficiency of zinc element will seriously affect the body's growth and development, reproduction, immunity and other processes. [0003] Brassica napus is evolved from cabbage and cabbage through natural interspecific hybridization and doubling, and its vegetable properties have a scientific basis in origin and evolution. With the widespread promotion of canola varieties, rapeseed seedlings and stalks are gradually being recognized by consumers as delicious vegetables. Studies have shown that rape is a good plant transformation carrier for zinc, and cultiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2531/113C12Q2535/122C12Q2525/191
Inventor 王汉中任丽军顿小玲王新发刘贵华田泽
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI