Molecular marker BnZn-3A1 closely linked with rape zinc content character QTL and application of molecular marker BnZn-3A1
A technology of bnzn-3a1-f2, zinc content, applied in the fields of molecular biology and genetic breeding, can solve the problems of long breeding cycle, difficult breeding improvement, low selection efficiency, etc., to speed up the breeding process, shorten the breeding cycle, reduce the The effect of workload
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Obtainment of the main QTL locus qBnZn-3A1 for the zinc content trait in rapeseed:
[0029] (1) Collect 327 inbred lines of Brassica napus from various countries in the world as the related group of rape The rapeseed 50K Illumina SNP chip developed by the company performs genotype analysis on each sample.
[0030] (2) Use Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate), and least allele of the population material at each locus Gene frequency (minor allele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique matching of the SNP marker in the Brassica napus Darmor genome (Chalhoub et al., 2014) were used as the screening criteria to filter the SNP markers, and finally obtained 21,243 high-quality SNP markers for genome-wide association analysis.
[0031] (3) The genotype data of the obtained ass...
Embodiment 2
[0035] Obtaining of a molecular marker primer closely linked to the QTL locus qBnZn-3A1 for the trait of zinc content in rapeseed:
[0036] (1) Extract the sequence of 100 bp upstream and downstream of the 9886351st base of the Brassica napus chromosome A03, according to the KASP (Kompetitive Allele-Specific PCR, that is, competitive allele-specific PCR) molecular marker primer design principle, for its sense strand , developed the KASP molecular marker BnZn-3A1, which includes two competitive forward primers BnZn-3A1-F1 and BnZn-3A1-F2, corresponding to the sequence bases A and G of the above SNP variation sites, and a reverse Universal primer BnZn-3A1-R, the primer sequence is as follows:
[0037] BnZn-3A1-F1: gtggggccaactaatctgtga
[0038] BnZn-3A1-F2: tggggccaactaatctgtgg
[0039] BnZn-3A1-R: ccaccggagatttatatgatcgt
[0040] The above primers should be based on the principle of KASP marker development, and a KASP marker universal linker should be added before use.
[0...
Embodiment 3
[0047] The application of primers designed based on the 9886351st base of rape A03 chromosome in the screening and breeding of rapeseed zinc content traits, the steps are as follows:
[0048] (1) Among the 327 materials, 25 materials with higher zinc content and 25 materials with lower zinc content that have been homozygous after multiple generations of self-breeding were selected, and the rapeseed hydroponic nutrition system containing 0.22 mg / L zinc element was used to cultivate it to the five-leaf stage. , Determination of zinc content in vegetable seedlings by flame atomic absorption spectrometry.
[0049] (2) To examine the distribution of the two genotypes of the molecular marker BnZn-3A1 in the above-mentioned materials with high and low zinc content. The results showed that the genotype of molecular marker BnZn-3A1 was A in 11 and B in 14 of the 25 materials with high zinc content, while 17 of the 25 materials with low zinc content were A and 8 were B. B (Table 1).
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

