Plant starch synthesis-associated protein OsFLO10 as well as encoding gene and application thereof
A technology related to protein and starch, applied in the field of genetic engineering, can solve problems such as functions that have not been studied
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1. Discovery of plant starch synthesis-related proteins and their encoding genes
[0048] 1. Phenotype analysis and genetic analysis of rice starch synthesis mutant flo10
[0049] The rice variety N22 was screened out from the MNU mutation mutant library to screen out the seed farinity opaque mutant flo10.
[0050] figure 1 The picture on the left is a scan of the whole and cross-section of N22 mature seeds, showing the phenotype of completely transparent endosperm. The picture on the right is the scan of the whole and cross-section of flo10 mature seeds, showing the phenotype of full powder endosperm.
[0051] figure 2 SEM analysis images for N22 and flo10. The scanning electron microscope of the mature seeds of N22 showed that the starch granules were tightly arranged and uniform in size, while the starch granules in flo10 were loosely arranged and most of the granules were round. Scattering occurs when light passes through, resulting in an opaque phenoty...
Embodiment 2
[0089] Embodiment 2, the acquisition and identification of transgenic plants
[0090] 1. Construction of recombinant expression vector
[0091] Using the cDNA of N22 as a template, PCR amplification was performed to obtain the coding sequence of the OsFLO10 gene. The PCR primer sequences are as follows:
[0092] primer3:
[0093] 5'TTACTTCTGCACTAGGTACCATGTGGAAGACTTTGCAGTTATGCA3' (SEQ ID NO. 6)
[0094] primer4:
[0095] 5'AGCGTTAACACTAGTCTCACGGGGAGTTCACTTGAGTTGAA 3' (SEQ ID NO. 7)
[0096] The above primers are respectively located at the upstream of ATG to the downstream of TGA of the gene shown in sequence 2, the amplified product contains the entire coding region of the gene, and the PCR product is recovered and purified. Use the Infusion Recombination Kit (Clontech) to clone the PCR product into the vector pCUBi1390 to construct pCUBi1390-OsFLO10; recombination reaction system (10.0 μL): PCR product 5.4 μL (50-100ng), pCUBi1390 vector 1.6 μL (30-50ng) , 5×Infusion buf...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com