Plant starch synthesis-associated protein OsFLO10 as well as encoding gene and application thereof

A technology related to protein and starch, applied in the field of genetic engineering, can solve problems such as functions that have not been studied

Active Publication Date: 2018-11-16
NANJING AGRICULTURAL UNIVERSITY
View PDF6 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

OsFLO10 is a member of the PPR protein family,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant starch synthesis-associated protein OsFLO10 as well as encoding gene and application thereof
  • Plant starch synthesis-associated protein OsFLO10 as well as encoding gene and application thereof
  • Plant starch synthesis-associated protein OsFLO10 as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1. Discovery of plant starch synthesis-related proteins and their encoding genes

[0048] 1. Phenotype analysis and genetic analysis of rice starch synthesis mutant flo10

[0049] The rice variety N22 was screened out from the MNU mutation mutant library to screen out the seed farinity opaque mutant flo10.

[0050] figure 1 The picture on the left is a scan of the whole and cross-section of N22 mature seeds, showing the phenotype of completely transparent endosperm. The picture on the right is the scan of the whole and cross-section of flo10 mature seeds, showing the phenotype of full powder endosperm.

[0051] figure 2 SEM analysis images for N22 and flo10. The scanning electron microscope of the mature seeds of N22 showed that the starch granules were tightly arranged and uniform in size, while the starch granules in flo10 were loosely arranged and most of the granules were round. Scattering occurs when light passes through, resulting in an opaque phenoty...

Embodiment 2

[0089] Embodiment 2, the acquisition and identification of transgenic plants

[0090] 1. Construction of recombinant expression vector

[0091] Using the cDNA of N22 as a template, PCR amplification was performed to obtain the coding sequence of the OsFLO10 gene. The PCR primer sequences are as follows:

[0092] primer3:

[0093] 5'TTACTTCTGCACTAGGTACCATGTGGAAGACTTTGCAGTTATGCA3' (SEQ ID NO. 6)

[0094] primer4:

[0095] 5'AGCGTTAACACTAGTCTCACGGGGAGTTCACTTGAGTTGAA 3' (SEQ ID NO. 7)

[0096] The above primers are respectively located at the upstream of ATG to the downstream of TGA of the gene shown in sequence 2, the amplified product contains the entire coding region of the gene, and the PCR product is recovered and purified. Use the Infusion Recombination Kit (Clontech) to clone the PCR product into the vector pCUBi1390 to construct pCUBi1390-OsFLO10; recombination reaction system (10.0 μL): PCR product 5.4 μL (50-100ng), pCUBi1390 vector 1.6 μL (30-50ng) , 5×Infusion buf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of genetic engineering, and relates to plant starch synthesis-associated protein OsFLO10 as well as an encoding gene and an application thereof. The protein is shownin following (a) or (b): (a) protein consisting of an amino acid sequence shown in sequence 1 in a sequence table; (b) protein which is derived from the sequence 1, obtained by the amino acid sequence shown in the sequence 1 by substitution and/or deletion and/or addition of one or more amino acid residues and associated with plant gluten sorting. The plant starch synthesis-associated protein OsFLO10 affects synthesis of starch in plant endosperm. After the encoding gene of the protein is introduced into plants with abnormal starch synthesis, transgenic plants with normal starch synthesis canbe cultivated. The protein and the encoding gene thereof can be applied to plant genetic improvement.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a plant starch synthesis related protein OsFLO10 and its coding gene and application. Background technique [0002] Rice (Oryza sativa L.) grains accumulate a large amount of starch during the maturation process, which provides the main energy for seed germination and seedling growth and development, and also becomes an important food source for humans. The accumulation of starch not only affects the yield of rice, but its content and characteristics directly determine the quality of rice. Therefore, through the study of starch mutants and the discovery of key genes for starch synthesis, it not only scientifically clarifies the mechanism of rice starch synthesis and regulation, but also has important guiding significance for improving rice quality in breeding. [0003] Rice starch is mainly composed of amylose and amylopectin. Amylose is synthesized by granule-bound starch synth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8245
Inventor 万建民任玉龙巫明明江玲张文伟田云录刘喜刘世家陈亮明
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap