Unlock instant, AI-driven research and patent intelligence for your innovation.

A molecular marker associated with rapeseed thousand-grain weight and its application

A thousand-grain weight, rapeseed technology, applied in the fields of molecular biology and genetic breeding, can solve the problems of threatening supply security, small repeatability, and high cost, and achieve the effects of improving screening efficiency and accuracy, speeding up the breeding process, and shortening the breeding cycle

Active Publication Date: 2020-06-05
OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the self-sufficiency rate of domestic vegetable oil in my country is less than 35%, which seriously threatens its supply security.
However, AFLP markers also have some disadvantages: high cost, complex process, and technical difficulty; most of the markers are dominant markers; there are high requirements for DNA quality and restriction endonuclease quality
There are also some reports on QTL mapping of rapeseed thousand-grain weight (Quijada et al., 2006; Udall et al., 2006; Radoev et al., 2008; Shi et al., 2009; Wang Feng et al., 2010; Basunanda et al., 2010; Fan et al., 2010; Zhang et al., 2011; Zhao Weiguo et al., 2017), but usually the detected QTL effect value is small and the repeatability is not good, so it is difficult to apply in rapeseed breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker associated with rapeseed thousand-grain weight and its application
  • A molecular marker associated with rapeseed thousand-grain weight and its application
  • A molecular marker associated with rapeseed thousand-grain weight and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Acquisition of SNP markers significantly associated with rapeseed thousand-grain weight:

[0031] (1) Collect 331 inbred lines of Brassica napus from various countries in the world as the core related population of rapeseed, collect individual leaves of each line of the related population, extract the total DNA by CTAB method, and use the rapeseed 60K SNP chip to analyze each sample Perform genotype analysis.

[0032] (2) Use the Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each locus Gene frequency (minor allele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique match of the SNP marker in the Brassica napus genome were used as the screening criteria to filter the SNP markers, and finally 24,508 high-quality SNP markers were obtained for the ...

Embodiment 2

[0036] Acquisition of a molecular marker primer significantly associated with thousand-grain weight:

[0037] (1) Extract the sequence of 100bp upstream and downstream of the 27th, 766, 971th base of rapeseed chromosome A09, and develop the SNP marker primer snpA9-4 according to the primer design principle, the forward primer is snpA9-4F: GTGGTGCCATTGCACTAGAAA, and the reverse primer is snpA9-4R: CCAATGCAGGAACAGAACAGC, the amplicon size is 133bp.

[0038] The sequence amplified in Brassica napus small-grain material Tapidor (the average thousand-grain weight is 2.86g) is the AA genotype, and the sequence is as follows:

[0039] CCAATGCAGGAACAGAACAGCAACAGCTTGTGACAAGGCACTTTGTTTTAAGATTTTGTCTATCTTGTACAGTTTCACTGCCACTGCAAAGGTCAAAGATCTCTAGTTGACCTTTCTAGTGCAATGGCACCAC

[0040] The sequence amplified in Brassica napus large-grain material Qing613 (the average thousand-grain weight is 5.02g) is CC genotype, and the sequence is as follows:

[0041] CCAATGCAGGAACAGAACAGCAACAGCTTGTGACAAGG...

Embodiment 3

[0049] The application of primers designed based on base 27,766,971 of rapeseed A09 chromosome in thousand-grain weight screening and breeding of rapeseed, the steps are as follows:

[0050] (1) Among the 331 materials, 20 materials with small thousand-grain weight (Li et al., 2014) and 19 materials with large thousand-grain weight (Li et al., 2014) were selected after multiple generations of self-crossing.

[0051] (2) The distribution of the two genotypes of snpA9-4, a molecular marker significantly associated with thousand-grain weight, in 20 materials with small thousand-grain weight and 19 materials with large thousand-grain weight were examined. The results showed that the genotype of the molecular marker snpA9-4 was AA genotype in 19 of the 20 small thousand-grain weight materials, but only 6 of the 1000-grain weight materials were AA (Table 1). In addition, among the 331 related populations, 228 were AA samples with molecular marker snpA9-4, and the average thousand-gr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker associated with thousand-grain weight of rape and an application. SNP (single nucleotide polymorphism) label notably associated with the thousand-grain weight of rape is obtained, is located at the 27,766,971st base of rape A09 chromosome, and can explain the phenotypic variation of 8.4% on the average, the average additive effect is -0.28, and the condition that differences being 0.56g exist between the thousand-grain weight of the rape of two kinds of homozygosis allele can be explained theoretically. The primer designed by the molecular marker is snpA9-4F: GTGGTGCCATTGCACTAGAAA, snpA9-4R: CCAATGCAGGAACAGAACAGC. The molecular marker snpA9-4 notably associated with the thousand-grain weight of the rape is inspected, so that the size of the thousand-grain weight of the rape can be predicted, and good single plants being high in thousand-grain weight can be quickly and accurately screened.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and in particular relates to a molecular marker significantly correlated with 1000-grain weight of Brassica napus and application thereof. Background technique [0002] Rapeseed oil is the largest source of domestic edible vegetable oil, accounting for more than 55% of the total vegetable oil production in my country (Wang Hanzhong, 2018). However, the self-sufficiency rate of domestic vegetable oil in my country is less than 35%, which seriously threatens its supply security. In order to ensure the effective supply of domestic vegetable oil in my country, under the condition of weak growth of planting area, continuous improvement of oil production per unit area (= unit yield × oil content) is the only way out. In recent years, my country's rapeseed high-oil breeding has made breakthroughs (Fu Tingdong, 2014), but the yield per unit area is still lower than the wor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 王汉中师家勤宋东霁王新发刘贵华詹杰鹏
Owner OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More