A molecular marker associated with rapeseed thousand-grain weight and its application
A thousand-grain weight, rapeseed technology, applied in the fields of molecular biology and genetic breeding, can solve the problems of threatening supply security, small repeatability, and high cost, and achieve the effects of improving screening efficiency and accuracy, speeding up the breeding process, and shortening the breeding cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Acquisition of SNP markers significantly associated with rapeseed thousand-grain weight:
[0031] (1) Collect 331 inbred lines of Brassica napus from various countries in the world as the core related population of rapeseed, collect individual leaves of each line of the related population, extract the total DNA by CTAB method, and use the rapeseed 60K SNP chip to analyze each sample Perform genotype analysis.
[0032] (2) Use the Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each locus Gene frequency (minor allele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique match of the SNP marker in the Brassica napus genome were used as the screening criteria to filter the SNP markers, and finally 24,508 high-quality SNP markers were obtained for the ...
Embodiment 2
[0036] Acquisition of a molecular marker primer significantly associated with thousand-grain weight:
[0037] (1) Extract the sequence of 100bp upstream and downstream of the 27th, 766, 971th base of rapeseed chromosome A09, and develop the SNP marker primer snpA9-4 according to the primer design principle, the forward primer is snpA9-4F: GTGGTGCCATTGCACTAGAAA, and the reverse primer is snpA9-4R: CCAATGCAGGAACAGAACAGC, the amplicon size is 133bp.
[0038] The sequence amplified in Brassica napus small-grain material Tapidor (the average thousand-grain weight is 2.86g) is the AA genotype, and the sequence is as follows:
[0039] CCAATGCAGGAACAGAACAGCAACAGCTTGTGACAAGGCACTTTGTTTTAAGATTTTGTCTATCTTGTACAGTTTCACTGCCACTGCAAAGGTCAAAGATCTCTAGTTGACCTTTCTAGTGCAATGGCACCAC
[0040] The sequence amplified in Brassica napus large-grain material Qing613 (the average thousand-grain weight is 5.02g) is CC genotype, and the sequence is as follows:
[0041] CCAATGCAGGAACAGAACAGCAACAGCTTGTGACAAGG...
Embodiment 3
[0049] The application of primers designed based on base 27,766,971 of rapeseed A09 chromosome in thousand-grain weight screening and breeding of rapeseed, the steps are as follows:
[0050] (1) Among the 331 materials, 20 materials with small thousand-grain weight (Li et al., 2014) and 19 materials with large thousand-grain weight (Li et al., 2014) were selected after multiple generations of self-crossing.
[0051] (2) The distribution of the two genotypes of snpA9-4, a molecular marker significantly associated with thousand-grain weight, in 20 materials with small thousand-grain weight and 19 materials with large thousand-grain weight were examined. The results showed that the genotype of the molecular marker snpA9-4 was AA genotype in 19 of the 20 small thousand-grain weight materials, but only 6 of the 1000-grain weight materials were AA (Table 1). In addition, among the 331 related populations, 228 were AA samples with molecular marker snpA9-4, and the average thousand-gr...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com