A molecular marker associated with rapeseed thousand-grain weight and its application

Abstract

The invention discloses a molecular marker associated with thousand-grain weight of rape and an application. SNP (single nucleotide polymorphism) label notably associated with the thousand-grain weight of rape is obtained, is located at the 27,766,971st base of rape A09 chromosome, and can explain the phenotypic variation of 8.4% on the average, the average additive effect is -0.28, and the condition that differences being 0.56g exist between the thousand-grain weight of the rape of two kinds of homozygosis allele can be explained theoretically. The primer designed by the molecular marker is snpA9-4F: GTGGTGCCATTGCACTAGAAA, snpA9-4R: CCAATGCAGGAACAGAACAGC. The molecular marker snpA9-4 notably associated with the thousand-grain weight of the rape is inspected, so that the size of the thousand-grain weight of the rape can be predicted, and good single plants being high in thousand-grain weight can be quickly and accurately screened.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and in particular relates to a molecular marker significantly correlated with 1000-grain weight of Brassica napus and application thereof. Background technique [0002] Rapeseed oil is the largest source of domestic edible vegetable oil, accounting for more than 55% of the total vegetable oil production in my country (Wang Hanzhong, 2018). However, the self-sufficiency rate of domestic vegetable oil in my country is less than 35%, which seriously threatens its supply security. In order to ensure the effective supply of domestic vegetable oil in my country, under the condition of weak growth of planting area, continuous improvement of oil production per unit area (= unit yield × oil content) is the only way out. In recent years, my country's rapeseed high-oil breeding has made breakthroughs (Fu Tingdong, 2014), but the yield per unit area is still lower than the wor...

AI Technical Summary

Problems solved by technology

However, the self-sufficiency rate of domestic vegetable oil in my country is less than 35%, which seriously threatens its supply security.

However, AFLP markers also have some disadvantages: high cost, complex process, and technical difficulty; most of the markers are dominant markers; there are high requirements for DNA quality and restriction endonuclease quality

There are also some reports on QTL mapping of rapeseed thousand-grain weight (Quijada et al., 2006; Udall et al., 2006; Radoev et al., 2008; Shi et al., 2009; Wang Feng et al., 2010; Basunanda et al., 2010; Fan et al., 2010; Zhang et al., 2011; Zhao Weiguo et al., 2017), but usually the detected QTL effect value is small and the repeatability is not good, so it is difficult to apply in rapeseed breeding

Images