Double PCR primer set for simultaneous detection of MS-H vaccine strain and versatility and kit
A technology of MS-H and vaccine strains, applied in the direction of recombinant DNA technology, microorganisms, and methods based on microorganisms, etc., can solve the problems of decreased quality of broiler carcass, increased drug use for diseased groups, and increased waste rate, etc., achieving short detection cycles and strong Specificity and accuracy, practical effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] 1. Design specific primers
[0034] According to the sequence differences in GenBank, we used Primer 5 software to design a dual PCR primer set for simultaneous detection of Mycoplasma Synovium MS-H vaccine strain and universal type. The specific sequence is as follows:
[0035] Vaccine strain upstream primer (SEQ IDNO:1): TGTATAGTAACGCCCTTCGC
[0036] Downstream primer of vaccine strain (shown in SEQ ID NO: 2): CTTCTTGAAGGTGAAACCAA
[0037] Universal upstream primer (shown in SEQ ID NO: 3): CTATTAGCAGCTAGTGCAGTGG
[0038] Universal downstream primer (shown in SEQ ID NO: 4): ACCGATCCGCTTAATGCTCTTAC
[0039] 2. Nucleic acid extraction
[0040] Refer to the cotton swab DNA extraction kit instructions of Qingdao Insite Biotechnology Co., Ltd. to extract the DNA of various mycoplasma and store at -20°C.
[0041] 3. Specificity test of chicken Mycoplasma synovial sac MS-H vaccine strain and universal double PCR
[0042] This time, the nucleic acid of Mycoplasma gallisepticum and Mycoplasm...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


