A method for rapidly constructing recombinant strains of Aspergillus
A technology of Aspergillus and strains, applied in the field of rapid construction of recombinant strains of Aspergillus, can solve the problems of difficult gene targeting, difficulty in strain purification, poor HR effect of heterokaryons, etc., and achieve the effect of improving the probability of homozygotes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1: Construction of homologous recombination strains of Aspergillus niger using CRISPR-Cas9
[0033] The CRISPR-Cas9 system includes the Cas9 gene, sgRNA, and screening markers.
[0034] Cas9 protein was expressed using Aspergillus strong promoters such as Aspergillus promoter Pgla or Ptef.
[0035] Using PgpdA or Pu6 promoter, albA-sgRNA and kusA-sgRNA (see Table 1 for sgRNA sequence list), gRNAbackbone sequence
[0036] (GTTTTAGGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC), terminator TtrpC or Tu6 to construct the sgRNA expression cassette.
[0037] Table 1 Target gene sgRNA sequence list
[0038] target gene target gene sequence albA AGTGGGATCTCAAGAACTAC kusA CGAGCACTGGTAGATGATGA
[0039] Selectable markers include hygromycin B (hyg), orotidine-5'-phosphate dehydroxylase, acetamidase, which are commonly used in Aspergillus, and other filamentous fungal markers with similar efficacy. The hygromycin resis...
Embodiment 2
[0048] Example 2: Construction of non-homologous recombination-deficient strains using Aspergillus niger homologous recombination
[0049] Using Vazyme II One Step Cloning Kit, using pUC19 as the vector backbone, recombine and synthesize the kusA upper and lower homology arms and resistance genes shown in SEQ ID NO.4 and SEQ ID NO.5 to obtain the kusA knockout plasmid pUC-KU (See the plasmid map image 3 )
[0050] Use the protoplast transformation method to transfer the kusA knockout frame into the host:
[0051] Cultivate Aspergillus niger mycelium overnight in PDA medium, collect mycelia, wash mycelia three times with normal saline; hydrolyze with Lysozyme for 3 hours, and prepare protoplasts after filtering with four layers of lens cleaning paper; centrifuge at 4°C and 1000rpm Collect the protoplasts and wash the protoplasts 2-3 times with pre-cooled STC; take 100 μL of the prepared protoplasts and add 10 μL of the kusA knockout frame to mix well, add 2 mL PEG 6000, an...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


