Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for rapidly constructing recombinant strains of Aspergillus

A technology of Aspergillus and strains, applied in the field of rapid construction of recombinant strains of Aspergillus, can solve the problems of difficult gene targeting, difficulty in strain purification, poor HR effect of heterokaryons, etc., and achieve the effect of improving the probability of homozygotes

Active Publication Date: 2021-07-27
JIANGNAN UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Knocking out the kusA gene using traditional homologous recombination targeting technology is a labor-intensive task. Since the host has a low chance of HR without destroying kusA, it is difficult to carry out gene targeting; secondly, the kusA gene The deletion of the strain increases the probability of heterokaryon formation, which brings difficulty to the purification of the strain, and the HR effect of the heterokaryon is not good

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for rapidly constructing recombinant strains of Aspergillus
  • A method for rapidly constructing recombinant strains of Aspergillus
  • A method for rapidly constructing recombinant strains of Aspergillus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction of homologous recombination strains of Aspergillus niger using CRISPR-Cas9

[0033] The CRISPR-Cas9 system includes the Cas9 gene, sgRNA, and screening markers.

[0034] Cas9 protein was expressed using Aspergillus strong promoters such as Aspergillus promoter Pgla or Ptef.

[0035] Using PgpdA or Pu6 promoter, albA-sgRNA and kusA-sgRNA (see Table 1 for sgRNA sequence list), gRNAbackbone sequence

[0036] (GTTTTAGGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC), terminator TtrpC or Tu6 to construct the sgRNA expression cassette.

[0037] Table 1 Target gene sgRNA sequence list

[0038] target gene target gene sequence albA AGTGGGATCTCAAGAACTAC kusA CGAGCACTGGTAGATGATGA

[0039] Selectable markers include hygromycin B (hyg), orotidine-5'-phosphate dehydroxylase, acetamidase, which are commonly used in Aspergillus, and other filamentous fungal markers with similar efficacy. The hygromycin resis...

Embodiment 2

[0048] Example 2: Construction of non-homologous recombination-deficient strains using Aspergillus niger homologous recombination

[0049] Using Vazyme II One Step Cloning Kit, using pUC19 as the vector backbone, recombine and synthesize the kusA upper and lower homology arms and resistance genes shown in SEQ ID NO.4 and SEQ ID NO.5 to obtain the kusA knockout plasmid pUC-KU (See the plasmid map image 3 )

[0050] Use the protoplast transformation method to transfer the kusA knockout frame into the host:

[0051] Cultivate Aspergillus niger mycelium overnight in PDA medium, collect mycelia, wash mycelia three times with normal saline; hydrolyze with Lysozyme for 3 hours, and prepare protoplasts after filtering with four layers of lens cleaning paper; centrifuge at 4°C and 1000rpm Collect the protoplasts and wash the protoplasts 2-3 times with pre-cooled STC; take 100 μL of the prepared protoplasts and add 10 μL of the kusA knockout frame to mix well, add 2 mL PEG 6000, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly constructing aspergillus recombinant strains, belonging to the technical field of genetic engineering. The present invention cuts the Aspergillus niger albA gene and the Aspergillus niger kusA gene simultaneously by CRISPR-Cas9, and rapidly screens the Aspergillus niger kusA mutant strain through the spore phenotype. The probability of homozygosity, the destruction probability of white mutant kusA reaches 50%, and the probability of purifier reaches 100%.

Description

technical field [0001] The invention relates to a method for quickly constructing a recombinant strain of Aspergillus, belonging to the technical field of genetic engineering. Background technique [0002] Aspergillus niger is an important industrial production strain, which belongs to a kind of filamentous fungus. Due to its special physiological structure, it is difficult to edit its gene. Non-homologous recombination (NHEJ) and homologous recombination (HR) mechanisms coexist in Aspergillus niger to maintain its DNA damage repair. Among them, the probability of NHEJ is significantly higher than that of HR. During the process of homologous arm recombination, the transformation fragment is often inserted randomly in the form of NHEJ, which makes it very difficult to target the target gene to replace the high-expression site. Since the integration site is one of the important factors affecting the expression level of the recombinant gene during the expression of the recombi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/15C12N15/90C12N15/113C12N15/80C12R1/685
CPCC07K14/38C12N15/113C12N15/80C12N15/902C12N2310/20
Inventor 刘松李岑堵国成陈坚周景文
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com