Method for quickly constructing aspergillus niger recombinant strain

A technology of Aspergillus and strains, which is applied in the field of rapid construction of Aspergillus recombinant strains, which can solve the problems of difficult gene targeting, increased probability of strain heterokaryon formation, difficulty in strain purification, etc., to improve efficiency, increase homozygosity probability, simplify screening and The effect of purification

Active Publication Date: 2019-11-12
JIANGNAN UNIV
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Knocking out the kusA gene using traditional homologous recombination targeting technology is a labor-intensive task. Since the host has a low chance of HR without destroying kusA, it is difficult to carry out gene targeting; secondly, the kusA gene The deletion of the strain increases the probability of heterokaryon formation, which brings difficulty to the purification of the strain, and the HR effect of the heterokaryon is not good

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly constructing aspergillus niger recombinant strain
  • Method for quickly constructing aspergillus niger recombinant strain
  • Method for quickly constructing aspergillus niger recombinant strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction of homologous recombination strains of Aspergillus niger using CRISPR-Cas9

[0033] The CRISPR-Cas9 system includes the Cas9 gene, sgRNA, and screening markers.

[0034] Cas9 protein was expressed using Aspergillus strong promoters such as Aspergillus promoter Pgla or Ptef.

[0035] Using PgpdA or Pu6 promoter, albA-sgRNA and kusA-sgRNA (see Table 1 for sgRNA sequence list), gRNAbackbone sequence

[0036] (GTTTTAGGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC), terminator TtrpC or Tu6 to construct the sgRNA expression cassette.

[0037] Table 1 Target gene sgRNA sequence list

[0038] target gene target gene sequence albA AGTGGGATCTCAAGAACTAC kusA CGAGCACTGGTAGATGATGA

[0039] Selectable markers include hygromycin B (hyg), orotidine-5'-phosphate dehydroxylase, acetamidase, which are commonly used in Aspergillus, and other filamentous fungal markers with similar efficacy. The hygromycin resis...

Embodiment 2

[0048] Example 2: Construction of non-homologous recombination-deficient strains using Aspergillus niger homologous recombination

[0049] Using Vazyme II One Step Cloning Kit, using pUC19 as the vector backbone, recombine and synthesize the kusA upper and lower homology arms and resistance genes shown in SEQ ID NO.4 and SEQ ID NO.5 to obtain the kusA knockout plasmid pUC-KU (See the plasmid map image 3 )

[0050] Use the protoplast transformation method to transfer the kusA knockout frame into the host:

[0051] Cultivate Aspergillus niger mycelium overnight in PDA medium, collect mycelia, wash mycelia three times with normal saline; hydrolyze with Lysozyme for 3 hours, and prepare protoplasts after filtering with four layers of lens cleaning paper; centrifuge at 4°C and 1000rpm Collect the protoplasts and wash the protoplasts 2-3 times with pre-cooled STC; take 100 μL of the prepared protoplasts and add 10 μL of the kusA knockout frame to mix well, add 2 mL PEG 6000, an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses a method for quickly constructing an aspergillus niger recombinant strain and belongs to the technical field of genetic engineering. Aspergillus niger albA gene and aspergillus niger kuSA gene are simultaneously sheared through CRISPR-Cas 9, and an aspergillus niger kuSA mutant strain is rapidly screened out through spore phenotyping. Compared with a homologous recombination method for mutating the kuSA gene, the method obviously improves homozygote probability of the homologous recombination strain, and enables damage probability of the white mutant kuSA to reach 50% and probability of homozygote to reach 100%.

Description

technical field [0001] The invention relates to a method for quickly constructing a recombinant strain of Aspergillus, belonging to the technical field of genetic engineering. Background technique [0002] Aspergillus niger is an important industrial production strain, which belongs to a kind of filamentous fungus. Due to its special physiological structure, it is difficult to edit its gene. Non-homologous recombination (NHEJ) and homologous recombination (HR) mechanisms coexist in Aspergillus niger to maintain its DNA damage repair. Among them, the probability of NHEJ is significantly higher than that of HR. During the process of homologous arm recombination, the transformation fragment is often inserted randomly in the form of NHEJ, which makes it very difficult to target the target gene to replace the high-expression site. Since the integration site is one of the important factors affecting the expression level of the recombinant gene during the expression of the recombi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12N15/90C12N15/113C12N15/80C12R1/685
CPCC07K14/38C12N15/113C12N15/80C12N15/902C12N2310/20
Inventor 刘松李岑堵国成陈坚周景文
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap