Supercharge Your Innovation With Domain-Expert AI Agents!

Primer group capable of accurately measuring ITS base sequence of cerasus schneideriana, synthesis and rapid molecular identification

A base sequence and accurate determination technology, which is applied in the determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of overlapping peaks of original species and the difficulty of obtaining ITS base sequences, etc.

Inactive Publication Date: 2020-01-07
NINGBO CITY COLLEGE OF VOCATIONAL TECH
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the early stage, the universal primers ITS4-ITS5 were amplified and sequenced. Most of the ITS sequence peaks of the plants of the genus Prunus were very good, and accurate ITS base sequences could be obtained, but there were also a few original species (such as Zhemin cherry, etc.) peak phenomenon, it is difficult to obtain an accurate ITS base sequence. After many experiments, factors such as template impurity and primer degradation were ruled out. It is speculated that the universal primer ITS4-ITS5 may have more than two binding sites on Zhemin cherry. There will be overlapping peaks, so it is necessary to screen specific primers on both sides of the ITS of Zhemin cherry to achieve the purpose of accurately determining the base sequence of the ITS

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group capable of accurately measuring ITS base sequence of cerasus schneideriana, synthesis and rapid molecular identification
  • Primer group capable of accurately measuring ITS base sequence of cerasus schneideriana, synthesis and rapid molecular identification
  • Primer group capable of accurately measuring ITS base sequence of cerasus schneideriana, synthesis and rapid molecular identification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0035] (1) Genomic DNA extraction

[0036] The young leaves of cherry plants contain more polysaccharides and polyphenols. Traditional CTAB method is difficult to extract high-quality DNA. Therefore, the test kit method (plant / fungal genomic DNA small amount extraction kit) was used for DNA extraction. After the extraction of DNA, after passing the purity (OD260 / OD280≈1.8) test, the DNA sample is diluted to 50ng·uL-1 with preheated TE, and stored at -20℃ for later use;

[0037] (2) Sequence source

[0038] Log in to NCBI ( http: / / www.ncbi.nlm.nih.gov / genbank ), search for Rosaceae plant ITS sequence, select GenBank: HG004841.1 (Rubus ellipticus genomicDNA containing 18S rRNA gene,ITS1,5.8S rRNA gene,ITS2and 28S rRNA gene,specimen voucher HITBC:Liana Mengsong 271_3_48), its base The sequence is as follows (shown in SEQ ID No. 4):

[0039] ATCGCGGCGACGTGGGCGGTTCGCTGTCTGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group capable of accurately measuring the ITS base sequence of cerasus schneideriana, synthesis and rapid molecular identification. The sequence of the primer group isshown as follows: 1f:5'-CTCCTCGTCCCTTTTCTC-3' (SEQ ID No.1) and 2r:5'-AGTTTCTTTTCCTCCGCT-3' (SEQ ID No.2). The invention relates to a specific pair of primers of 1f-2r, the primers can be used to acquire the ITS sequence of the cerasus schneideriana with good quality through PCR, and the 1f-2r is specific sequence primers for the cerasus schneideriana and used for ITS molecular sequence auxiliaryidentification by combining morphological classification; and in addition, the specific primer pair of 1f to 2r can accurately amplify the ITS sequence of the cerasus schneideriana and can provide acertain basis for population genetic diversity, phylogenesis, rapid molecular identification and the like of the cerasus schneideriana.

Description

Technical field [0001] The invention belongs to the technical field of plant gene sequences, and specifically relates to a primer set capable of accurately determining the base sequence of the ITS of Zhemin cherry, synthesis and rapid molecular identification. Background technique [0002] Since Linnaeus systematically classified biological species, biologists have used various biological traits such as color, appearance, and behavior to identify animals and plants. However, morphological classification has its serious shortcomings. The most important thing is the dependence on various specimens with complete morphological characteristics, especially angiosperms lacking flowers and fruits; secondly, the current taxonomic experts are declining. Sakura is easy to cross between species and is a relatively young genus. Some species have small morphological differences. Traditional morphological classification is difficult to distinguish them quickly and accurately. Molecular identifi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895
Inventor 付涛王志龙
Owner NINGBO CITY COLLEGE OF VOCATIONAL TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More