Primer group capable of accurately measuring ITS base sequence of cerasus schneideriana, synthesis and rapid molecular identification
A base sequence and accurate determination technology, which is applied in the determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of overlapping peaks of original species and the difficulty of obtaining ITS base sequences, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0035] (1) Genomic DNA extraction
[0036] The young leaves of cherry plants contain more polysaccharides and polyphenols. Traditional CTAB method is difficult to extract high-quality DNA. Therefore, the test kit method (plant / fungal genomic DNA small amount extraction kit) was used for DNA extraction. After the extraction of DNA, after passing the purity (OD260 / OD280≈1.8) test, the DNA sample is diluted to 50ng·uL-1 with preheated TE, and stored at -20℃ for later use;
[0037] (2) Sequence source
[0038] Log in to NCBI ( http: / / www.ncbi.nlm.nih.gov / genbank ), search for Rosaceae plant ITS sequence, select GenBank: HG004841.1 (Rubus ellipticus genomicDNA containing 18S rRNA gene,ITS1,5.8S rRNA gene,ITS2and 28S rRNA gene,specimen voucher HITBC:Liana Mengsong 271_3_48), its base The sequence is as follows (shown in SEQ ID No. 4):
[0039] ATCGCGGCGACGTGGGCGGTTCGCTGTCTGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCC...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap