Primers and methods for identifying north-south geographic populations of American eel
An eel, population technology, applied in the field of agronomy, can solve the problem of inability to meet the requirements of identification and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
no. 1 example
[0016] A primer for identifying the northern and southern geographical populations of American eel. The sequence from the 5' end to the 3' end of the primer sAr F1 is: TAACCAATAAAAAATGTAGAAAGGC; the sequence from the 5' end to the 3' end of the primer sAr R1 is: AATACATTATGTTTCTACCCTGGCCT. The size of the product fragment obtained using this primer was 510. The "G" and "C" marked in red and bold in the base sequence are bases at specific positions that have been artificially changed.
no. 2 example
[0018] A method for identifying the north-south geographical population of American eel, comprising the steps of:
[0019] S1. Extracting the DNA of the population of eels to be measured, the population of eels to be measured is South American eel or North American eel;
[0020] S2. Using the primers for identifying the north-south geographic populations of American eel to carry out improved touch-down PCR amplification on the DNA samples of eel populations to be measured;
[0021] The characteristics of the primers are as follows: the sequence from the 5' end to the 3' end of the primer sAr F1 is: TAACCAATAAAAAATGTAGAAAGGC; the sequence from the 5' end to the 3' end of the primer sAr R1 is: AATACATTATGTTTCTACCCTGGCCT; the size of the product fragment obtained by using this primer is 510; The "G" and "C" marked in red and bold in the base sequence are artificially altered bases at specific positions.
[0022] The specific conditions for the improved touch-down PCR amplificati...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More