Unlock instant, AI-driven research and patent intelligence for your innovation.

Primers and methods for identifying north-south geographic populations of American eel

An eel, population technology, applied in the field of agronomy, can solve the problem of inability to meet the requirements of identification and so on

Active Publication Date: 2022-05-13
JIMEI UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, using the differential sequence of the American eel D-loop gene in different geographical populations for primer design and common PCR methods cannot meet the requirements of identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

no. 1 example

[0016] A primer for identifying the northern and southern geographical populations of American eel. The sequence from the 5' end to the 3' end of the primer sAr F1 is: TAACCAATAAAAAATGTAGAAAGGC; the sequence from the 5' end to the 3' end of the primer sAr R1 is: AATACATTATGTTTCTACCCTGGCCT. The size of the product fragment obtained using this primer was 510. The "G" and "C" marked in red and bold in the base sequence are bases at specific positions that have been artificially changed.

no. 2 example

[0018] A method for identifying the north-south geographical population of American eel, comprising the steps of:

[0019] S1. Extracting the DNA of the population of eels to be measured, the population of eels to be measured is South American eel or North American eel;

[0020] S2. Using the primers for identifying the north-south geographic populations of American eel to carry out improved touch-down PCR amplification on the DNA samples of eel populations to be measured;

[0021] The characteristics of the primers are as follows: the sequence from the 5' end to the 3' end of the primer sAr F1 is: TAACCAATAAAAAATGTAGAAAGGC; the sequence from the 5' end to the 3' end of the primer sAr R1 is: AATACATTATGTTTCTACCCTGGCCT; the size of the product fragment obtained by using this primer is 510; The "G" and "C" marked in red and bold in the base sequence are artificially altered bases at specific positions.

[0022] The specific conditions for the improved touch-down PCR amplificati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

In order to solve the problem that using the differential sequence of the American eel D-loop gene in different geographical populations for primer design and common PCR method can not achieve the identification problem, the inventor improved the specificity of the primer by artificially changing the base at a specific position in the primer, and proposed a A primer that can effectively identify the geographical populations of American eel, and its specific characteristics are as follows: the sequence from 5' to 3' of sAr F1 is: TAACCAATAAAAAATGTAGAAAGGC; the sequence from 5' to 3' of primer sAr R1 is: AATACATTATGTTTCTACCCTGGCCT. The inventor also proposed a method for identifying the northern and southern geographical populations of American eel by using the above primers, which has the advantages of simple, fast, short time-consuming, large processing volume, low test cost, and accurate and reliable identification results.

Description

technical field [0001] The invention relates to the field of agronomy, in particular to a primer and a method for identifying the north-south geographic populations of American eel (Anguilla rostrata). Background technique [0002] my country's eel aquaculture production accounts for about 60% of the world's total. At present, eel breeding seedlings are completely dependent on natural eel seedlings, and there are a total of 19 eel species in the world. In natural sea areas, the same species of eels are distributed in different geographical populations. For example, American eels are divided into North American eels distributed in the United States and South American eels distributed in Central America such as the Caribbean. Due to the large difference in market prices between South American eel and North American eel, some merchants add low-priced eel to high-priced eel to obtain greater benefits. In addition, due to the different requirements for their breeding ecological...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888
Inventor 赖晓健彭帅
Owner JIMEI UNIV