Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primers and kit for detecting cat intestinal infection pathogens and application

A technology for detecting reagents and pathogens, applied in the biological field, can solve the problems that the accuracy cannot meet the market demand, the operation is difficult for ordinary veterinarians, and the types of pathogens are not perfect, so as to shorten the detection time, increase the cure rate and make the results easy.

Pending Publication Date: 2020-02-21
深圳芭卡生物科技有限公司
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the low accuracy of this technology, the positive coincidence rate is only about 60%, the accuracy has gradually failed to meet the market demand, and the types of pathogens that can be tested are not perfect, such as the most common intestinal infection pathogens in cats cannot be detected, etc., so Its market share is shrinking year by year
[0003] PCR testing has entered the pet medical market from the human medical market in the past two years. Its biggest advantage is high accuracy, but the cost of its equipment is also very high. The price of a single instrument is more than 50,000, and the operation is also very complicated. , it is difficult for ordinary veterinarians to operate
Moreover, the installation of its equipment requires a self-built experimental space, and it is necessary to ensure that the experimental environment is well ventilated, otherwise false positives are easy to occur, and most pet hospitals do not have the installation conditions
Due to the above reasons, the promotion of in-hospital testing of the existing PCR testing technology is not good, and only a few central hospitals of leading chain pet hospital companies are equipped with it.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and kit for detecting cat intestinal infection pathogens and application
  • Primers and kit for detecting cat intestinal infection pathogens and application
  • Primers and kit for detecting cat intestinal infection pathogens and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Embodiment 1, the preparation of the primer that detects cat enteric infection pathogen

[0080] A kind of primer of this embodiment detects cat enteric infection pathogen, it comprises two primer sets of FPV primer set and FCoV primer set, each set is made of F3 primer, B3 primer, FIP primer, BIP primer, LF primer, LB primer Composed of 6 primers, the sequence of which varies with the pathogens targeted; the FPV primer set includes the outer primer pair FPV-F3 and FPV-B3, the inner primer pair FPV-FIP and FPV-BIP, and the loop primer pair FPV-LF and FPV -LB; the FCoV primer set includes the outer primer pair FCoV-F3 and FCoV-B3, the inner primer pair FCoV-FIP and FCoV-BIP, and the loop primer pair FCoV-LF and FCoV-LB; the detailed sequence is as follows:

[0081] FPV-F3: AATCAAGCAGCAGATGGT

[0082] FPV-B3: tggatctgttggtagcaata

[0083] FPV-FIP: tcaggtgtttctcctgttgtagtaGATCCAAGATATGCATTTGGTAGA

[0084] FPV-BIP: AGATACAGGAAGATATCCAGAAGGAttatcatttgttacaggaaggtt

[008...

Embodiment 2

[0093] Embodiment 2, utilize the test kit that detects feline enteric infection pathogen to detect the sample to be tested

[0094] 1. Preparation of detection kit

[0095] The cat intestinal infection pathogen detection kit described in this embodiment includes two detection reagents of feline distemper virus and feline coronavirus, each reagent is composed of two parts respectively, the first part is a general RM part, and this part has two kinds The composition of the reagents is the same, all consisting of the following raw materials:

[0096] 1 µl Bst enzyme

[0097] 1 µl Hydroxynaphthol Blue (37.5 µM)

[0098] 2 μl MgSO4 (100mM)

[0099] 2.5 μl 10xBst buffer

[0100] 3 µl deionized water

[0101] 3.5 μl dNTP (10mM)

[0102] 4 microliters of betaine (5M); 17 microliters total.

[0103] The second part is the specific PM part, which is the aqueous solution of each primer. The concentration of the aqueous solution is 20 μM, and the volume of the PM part in each reage...

Embodiment 3

[0152] Embodiment 3, accuracy experiment

[0153] Cats with enteric infections can carry both feline distemper virus and feline coronavirus, or either of them. Take a healthy cat as sample 1 to be tested, and then set samples 2-4 to be tested according to the different conditions of the identified pathogens carried by the cat, see Table 1 for details:

[0154] Table 1

[0155]

[0156] Note: "-" means "no", "+" means "yes".

[0157] Each group of samples to be tested is detected by the detection method of Embodiment 2 respectively, and the detection results are observed after the detection is completed, such as figure 2 The detection result of sample 4 to be tested shows that, figure 2 The arrangement order of the middle reagents is: the left 1 is the negative control, and the left 2-3 are the reagents for detecting FPV and FCoV respectively. Depend on figure 2 It can be seen that the negative control of left 1 shows blue-purple, and the detection FPV of left 2-3, t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers and a kit for detecting cat intestinal infection pathogens and application. The primers comprise two primer groups: a Feline Picornavirus (FPV) primer group and a Feline coronavirus (FCoV) primer group, each of the two primer groups consists of six primers: a primer F3, a primer B3, a primer FIP, a primer BIP, a primer LF and a primer LB, and the sequences are different according to pathogens to which the primers aim. The detection kit comprises an FPV detection reagent, an FCoV detection reagent, a negative control, a pretreatment solution A and a pretreatmentsolution B. The use method of the kit comprises the following steps: dipping an infectious cat sample, treating the sample, putting the sample into the detection reagents, performing reaction at a constant temperature of 65 DEG C, and judging the yin-yang property according to the color change. The application is based on an LAMP technology, specifically amplifies pathogen gene segments, can finish sampling and detection within 60 minutes, and realizes high-precision detection results by using an operation mode which is most easy to master.

Description

technical field [0001] The invention belongs to the field of biology, and in particular relates to a primer, a kit and an application for detecting pathogens of intestinal infection in cats. Background technique [0002] At present, pet pathogen detection mainly includes three methods: colloidal gold test paper, PCR test, and third-party testing services. Colloidal gold test paper is the most commonly used technology. Colloidal gold test paper technology developed earlier and is the easiest to operate, so it currently has the highest market share, accounting for about 70% of the pathogen testing market, and the representative companies are industry giants IDEXX and Lint Pharmaceuticals. However, due to the low accuracy of this technology, the positive coincidence rate is only about 60%, the accuracy has gradually failed to meet the market demand, and the types of pathogens that can be tested are not perfect, such as the most common intestinal infection pathogens in cats cann...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6844C12Q2531/119
Inventor 熊庆廖羽彭冠华李俊华
Owner 深圳芭卡生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More