Method for synthesizing DNA nanosphere complementary chains and sequencing method

A technology of nanospheres and complementary chains, applied in the field of sequencing, can solve problems such as difficult hybridization, low sequencing signal, and low fluorescent signal

Pending Publication Date: 2020-06-16
MGI TECH CO LTD
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

like figure 1 As shown, the existing method is to use the sequencing strand of the first strand and the label (Barcode) primer on the new hybrid to generate a complementary strand, and after the first strand is sequenced through a long cycle (cycle), the sequencing primer of the first strand has already occupied the position, so Only one of the MDA primers (i.e., the Barcode primer) can fully hybridize to the adapter, and the other primer is difficult to hybridize. When performing MDA, only two primers (i.e., the Barcode primer and one sequencing strand) are amplified, and the sequencing strand primer The replacement efficiency will be low, which will affect the copy number of DNB, so that the sequencing signal will be low
In addition, after a strand is sequenced through a long cycle (cycle), some sequencing enzymes are bound to the sequencing strand and the remaining scar (scar) after excision of dNTP with fluorescence blocking will affect the displacement effect of Phi29 DNA polymerase, thereby affecting the copy of DNB number, the fluorescence signal is low, and it will also affect the quality of sequencing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing DNA nanosphere complementary chains and sequencing method
  • Method for synthesizing DNA nanosphere complementary chains and sequencing method
  • Method for synthesizing DNA nanosphere complementary chains and sequencing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0075] Primers and reagents used in the examples:

[0076] Primers for one-strand sequencing:

[0077] CAACTCCUTGGCUCACAGAACGACAUGGCTACGAUCCGACTT (SEQ ID NO: 1);

[0078] MDA Primer 1: AAGTCGGAGGCCAAGCGGTCTTAGAAGACAA (SEQ ID NO: 2);

[0079] MDA Primer 2: CAACTCCTTGGCTCACAGAACGACATGGCT (SEQ ID NO: 3);

[0080] USER enzyme (US NEB company, product number M5505L);

[0081] BGISEQ-500DNB Preparation and Loading Kit (Hua Da Gene Company, Cat. No. 85-05531-00);

[0082] BGISEQ-500 Sequencing Kit (PE100) (BGI Corporation);

[0083] BGISEQ-500 chip (BGI Corporation).

[0084] Taking the BGISEQ-500 platform as an example, the PE100 sequencing effect of the present invention is demonstrated:

[0085] (1) Synthesize a one-strand sequencing primer with U base modification, and dilute it with 5×SSC solution to a working solution concentration of 1 μM. The system is shown in Table 1 below:

[0086] Table 1

[0087]

[0088]

[0089] (2) DNB was prepared using BGISEQ-500DNB Prep...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for synthesizing DNA nanosphere complementary chains and a sequencing method. The method comprises the following steps: treating a product after one chain sequencingof a DNA nanosphere by using an enzyme, wherein a primer for one chain sequencing is modified, and after enzyme treatment, the modification is destroyed by the enzyme, so that the primer is digested;hybridizing a multiple displacement amplification primer with the product obtained in the previous step, wherein the multiple displacement amplification primer at least comprising a first primer, andthe first primer is completely or partially complementary to a primer binding region of one chain of sequencing; and under the action of polymerase with a chain displacement function, carrying out chain displacement reaction by taking the multiple displacement amplification primer and one chain as primers to generate DNA nanosphere complementary chains. According to the method disclosed by the invention, one chain of occupied primers are removed before MDA, and the position is vacated to carry out MDA primer hybridization, so that the quantity of hybridization primers is increased, and the copy number of DNB is increased.

Description

technical field [0001] The invention relates to the technical field of sequencing, in particular to a method for synthesizing complementary chains of DNA nanoballs and a sequencing method. Background technique [0002] Multiple Displacement Amplification (MDA) technology is widely used in whole-genome amplification, and it is currently the whole-genome amplification method with the widest coverage of the entire genome and the smallest amplification bias at each site. At present, this method is also used in the field of high-throughput sequencing, based on the principle of MDA to generate DNA nanoball (DNB) complementary strands (Rongqin Ke, et.al., US20160237488 A1) to achieve the sequencing of DNB paired ends. [0003] In the paired-end sequencing of DNB, after the first strand is sequenced, its complementary strand needs to be generated, and then its complementary strand should be sequenced. Therefore, the generation of complementary strands has a great influence on the q...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6806C12Q1/6874
CPCC12Q1/6806C12Q1/6874C12Q2531/119C12Q2537/143C12Q2521/531
Inventor王卉徐讯唐国鑫章文蔚徐崇钧陈奥邢承美温晴杨晋
OwnerMGI TECH CO LTD