A molecular marker related to duck beak color traits and its application
A molecular marker and trait technology, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] The application of the present invention comprises the following steps:
[0040] 1) Collect biological samples from multiple groups of pink-billed ducks and yellow-billed ducks, collect blood samples from the lower veins of duck wings, and extract genomic DNA from the blood samples;
[0041] 2) Take the extracted genomic DNA as a template, and carry out a conventional PCR reaction by PCR primers;
[0042] Upstream primer (5'-3'): AAGTCTTATCCAGGTCCAGTCA (SEQ ID NO.4);
[0043] Downstream primer (5'-3'): TTCTCTTCACGCTTCATTTGT (SEQ ID NO. 5).
[0044] The reaction system was 20uL, including 0.5uL of upstream and downstream primers, 2 uL of template DNA, 1.5uL of dNTP, 1uL of taqDNA polymerase, 12.5uL of sterile deionized water, and 2uL of 10×solution buffer. The reaction program was as follows: denaturation at 95°C for 5 min; (denaturation at 95°C for 30s, annealing at 55°C for 30s, extension at 72°C for 50s) × 30 cycles; the reaction product was stored at 12°C.
[0045...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
