Unlock instant, AI-driven research and patent intelligence for your innovation.

A molecular marker related to duck beak color traits and its application

A molecular marker and trait technology, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc.

Active Publication Date: 2022-07-22
SICHUAN AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Therefore, the molecular markers and their application to quickly and accurately determine the genotypes of duck yellow beak and pink beak from the molecular level need to be studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker related to duck beak color traits and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] The application of the present invention comprises the following steps:

[0040] 1) Collect biological samples from multiple groups of pink-billed ducks and yellow-billed ducks, collect blood samples from the lower veins of duck wings, and extract genomic DNA from the blood samples;

[0041] 2) Take the extracted genomic DNA as a template, and carry out a conventional PCR reaction by PCR primers;

[0042] Upstream primer (5'-3'): AAGTCTTATCCAGGTCCAGTCA (SEQ ID NO.4);

[0043] Downstream primer (5'-3'): TTCTCTTCACGCTTCATTTGT (SEQ ID NO. 5).

[0044] The reaction system was 20uL, including 0.5uL of upstream and downstream primers, 2 uL of template DNA, 1.5uL of dNTP, 1uL of taqDNA polymerase, 12.5uL of sterile deionized water, and 2uL of 10×solution buffer. The reaction program was as follows: denaturation at 95°C for 5 min; (denaturation at 95°C for 30s, annealing at 55°C for 30s, extension at 72°C for 50s) × 30 cycles; the reaction product was stored at 12°C.

[0045...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and relates to a molecular marker related to duck beak color traits and an application thereof; the molecular marker is located on the nucleotide sequence SEQ ID NO. 1 related to the duck beak color trait; The length of the 23-26th position of the nucleotide sequence shown in ID NO.1 is an insertion / deletion sequence of 4 bp, the invention also discloses its application, comprising the following steps: collecting the biological test material of the duck individual to be tested, Extract the genomic DNA of the individual biological samples of the duck to be tested; use the extracted genomic DNA as a template, design specific amplification primers, and then use the DNA as a template to carry out PCR amplification reaction to obtain PCR products; The PCR products are detected by electrophoresis, and then determined Gene sequence, the genotype corresponding to duck beak color can be determined by gene sequencing peak map; the molecular tag of the present invention can quickly identify the genotype of pink beak individuals, distinguish homozygous and heterozygous individuals in pink beak, and select and retain genes Type homozygous individuals can guarantee that the offspring of this group will be all pink-beaked individuals.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a molecular marker related to duck beak color traits and its application. Background technique [0002] Duck beak color is a quality trait and an important appearance trait of meat ducks. In meat duck breeding, duck beak color traits can be used as an external characteristic marker of breeds to realize the identification of breeds, and the genetic rules of beak color traits can be used in matching lines to control the provenance. In addition, beak color is also one of the considerations for consumers to buy meat ducks. Yellow beak meat ducks are often favored by consumers because of their bright beak color. Therefore, the research and development of the genetic mechanism of duck beak color has important economic value and production significance. [0003] The pink beak of ducks is dominant relative to the yellow beak. If a pure pink beak population is established, according to the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124
Inventor 刘贺贺王继文李亮胡继伟
Owner SICHUAN AGRI UNIV