Wheat TaDCL4 gene and application thereof in pollen fertility
A wheat and genetic technology, applied in the field of genetic engineering, can solve problems such as adverse effects on wheat yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0032] Experimental Example 1 Construction of Expression Vector
[0033] 1. Design of sgRNA targeting DCL4
[0034] The sequence of the wheat DCL4 gene is shown in SEQ ID NO. 1-3, the sgRNA sequence targeting the DCL4 gene is GACGTGATGTCTGCATCTTC, and the last three sequences of the sequence are marked as the PAM sequence. Find a suitable target site in the coding region of DCL4 gene through the website CRISPRdirect (http: / / crispr.dbcls.jp / ), find a 20bp sequence fragment before the PAM structure and set it as the target sequence, and select the sgRNA sequence as GACGTGATGTCTGCATCTTC .
[0035] 2. sgRNA annealing and duplex formation
[0036] The two oligos of the sgRNA of the DCL4 gene were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd. The oligonucleotides of the sgRNA correspond to DCL4-gR1-TaU3-F and DCL4-gR1-TaU3-R (Table 1) , the underlined bases in the primers match the sequences in the pBUE411 vector. The two oligos of the sgRNA were phosphorylated and ...
experiment example 2
[0043] Experimental Example 2 Transformation of common wheat with gene editing vector
[0044] 1. Medium preparation: see the literature Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol.1223 DOI10.007 / 978-1-4939-1695-5_15, SpringScience+Businedd Media New York 2015
[0045] 2. Agrobacterium transformation: Take the wheat ears that have been pollinated for about 15 days, take the grains and peel the embryos. The day before the test, the Agrobacterium suspension was shaken at 160 r and cultured at 28°C for 24 hours. After the ear was ready, the preparation of the Agrobacterium suspension was started. ) and mix well. After adding the prepared bacterial solution to infect for 5 minutes, it was placed on the co-cultivation medium and cultivated in the dark at 23 degrees for 3 days. After co-cultivation, they were placed on rest medium for 5 days in the dark at 25°C. The callus was transferred to selection medium 1. Seal the petri dishes with ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


