Unlock instant, AI-driven research and patent intelligence for your innovation.

Wheat TaDCL4 gene and application thereof in pollen fertility

A wheat and genetic technology, applied in the field of genetic engineering, can solve problems such as adverse effects on wheat yield

Active Publication Date: 2020-07-17
CROP RES INST SHANDONG ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These will adversely affect the yield of wheat

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat TaDCL4 gene and application thereof in pollen fertility
  • Wheat TaDCL4 gene and application thereof in pollen fertility
  • Wheat TaDCL4 gene and application thereof in pollen fertility

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0032] Experimental Example 1 Construction of Expression Vector

[0033] 1. Design of sgRNA targeting DCL4

[0034] The sequence of the wheat DCL4 gene is shown in SEQ ID NO. 1-3, the sgRNA sequence targeting the DCL4 gene is GACGTGATGTCTGCATCTTC, and the last three sequences of the sequence are marked as the PAM sequence. Find a suitable target site in the coding region of DCL4 gene through the website CRISPRdirect (http: / / crispr.dbcls.jp / ), find a 20bp sequence fragment before the PAM structure and set it as the target sequence, and select the sgRNA sequence as GACGTGATGTCTGCATCTTC .

[0035] 2. sgRNA annealing and duplex formation

[0036] The two oligos of the sgRNA of the DCL4 gene were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd. The oligonucleotides of the sgRNA correspond to DCL4-gR1-TaU3-F and DCL4-gR1-TaU3-R (Table 1) , the underlined bases in the primers match the sequences in the pBUE411 vector. The two oligos of the sgRNA were phosphorylated and ...

experiment example 2

[0043] Experimental Example 2 Transformation of common wheat with gene editing vector

[0044] 1. Medium preparation: see the literature Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol.1223 DOI10.007 / 978-1-4939-1695-5_15, SpringScience+Businedd Media New York 2015

[0045] 2. Agrobacterium transformation: Take the wheat ears that have been pollinated for about 15 days, take the grains and peel the embryos. The day before the test, the Agrobacterium suspension was shaken at 160 r and cultured at 28°C for 24 hours. After the ear was ready, the preparation of the Agrobacterium suspension was started. ) and mix well. After adding the prepared bacterial solution to infect for 5 minutes, it was placed on the co-cultivation medium and cultivated in the dark at 23 degrees for 3 days. After co-cultivation, they were placed on rest medium for 5 days in the dark at 25°C. The callus was transferred to selection medium 1. Seal the petri dishes with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wheat TaDCL4 gene and an application of the wheat TaDCL4 gene in pollen fertility. A constructed pBUE411-DCL4 binary vector with a DCL4 gene knockout function istransferred into wheat, the expression of the DCL4 gene in the wheat is silenced, wheat plants with pollen abortion can be obtained, the function of the wheat TaDCL4 gene in the pollen abortion is verified, and how the DCL4 gene in the wheat plays a role in a phasiRNA synthesis path and performs the biological function is understood.

Description

technical field [0001] The invention relates to a wheat TaDCL4 gene and its application in pollen fertility, and belongs to the field of genetic engineering. Background technique [0002] When wheat encounters unfavorable weather conditions such as low temperature or drought, pollen mother cells will not be able to meiosis normally. When cell division is inhibited, a large amount of abortive pollen will be produced, resulting in the formation of a large number of empty shells and shriveled grains. Or in case of severe drought, the cytoplasmic viscosity increases, which hinders the normal meiosis and produces a large amount of abortive pollen. These will adversely affect the yield of wheat. [0003] The research on pollen abortion at the molecular level will help to understand the internal causes of pollen abortion, so as to reduce its occurrence. In plants, phasiRNAs are mainly involved in plant growth and development, reproductive development and stress resistance (Deng ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/02A01H6/46
CPCC07K14/415C12N15/8289C12N15/8218
Inventor 张荣志李根英高洁张淑娟宋国琦李玉莲李吉虎李玮谷田田
Owner CROP RES INST SHANDONG ACAD OF AGRI SCI