Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit and method for quantitatively detecting methylation degree of human MGMT gene

A quantitative detection and methylation technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problem of high cost and achieve the effect of low cost and accurate quantitative detection

Pending Publication Date: 2020-07-24
SHENZHEN HAPLOX BIOTECH
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the pyrosequencing method can accurately detect the degree of methylation, this method requires specific special instruments and equipment, and the cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for quantitatively detecting methylation degree of human MGMT gene
  • Kit and method for quantitatively detecting methylation degree of human MGMT gene
  • Kit and method for quantitatively detecting methylation degree of human MGMT gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0052] 1. Primer and probe design

[0053] In this example, for the MGMT gene, the position containing more methylation sites is selected for design. In this example, the MGMT gene-specific MGMT primer pair and MGMT probe are designed at the position containing 5 CpG sites. At the same time, for the internal control β-Actin gene, β-Actin gene-specific primers and probes that can cooperate with MGMT primer pairs and MGMT probes for dual real-time fluorescence quantitative PCR, namely β-Actin primer pairs and β-Actin probes, were designed. Needle. The MGMT primer pair, MGMT probe, β-Actin primer pair and β-Actin probe designed in this example are shown in Table 1; all primer pairs and probes were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0054] Table 1 Specific primer pairs and probes

[0055] Primer or probe name Sequence (5'→3') SEQ ID NO. MGMT primer pair upstream primer CGCGTTTCGGATATGTTGGGG 1 MGMT primer pair downstream primer ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit and method for quantitatively detecting the methylation degree of a human MGMT gene. The kit comprises an MGMT gene detection reagent, an internal control beta-Actin genedetection reagent and a standard substance, wherein the MGMT gene detection reagent comprises an MGMT primer pair and an MGMT probe, and the sequences of the MGMT primer pair and the MGMT probe are as shown in SEQ ID No. 1 to SEQ ID No. 3 respectively; the internal control beta-Actin gene detection reagent comprises a beta-Actin primer pair and a beta-Actin probe, and the sequences of the beta-Actin primer pair and the beta-Actin probe are as shown in SEQ ID No. 4 to SEQ ID No. 6 respectively; the two probes are modified by different fluorophores; and the standard substance is formed by mixing a 100% methylated MGMT gene and a 0% methylated MGMT gene according to different proportions. According to the kit, dual real-time fluorescent quantitative PCR is adopted, a standard curve is drawnby utilizing the standard substance, the methylation degree of the MGMT gene is relatively quantified, and the kit is simple and convenient to use and low in cost.

Description

technical field [0001] The present application relates to the field of MGMT gene methylation detection, in particular to a kit and method for quantitatively detecting the methylation degree of human MGMT gene. Background technique [0002] The MGMT gene encodes an O6-methylguanine DNA methyltransferase. In normal cells, MGMT can remove the methyl group at the O6 position of abnormally methylated guanine, so that DNA damage caused by guanine methylation can be repaired. The loss of MGMT expression and DNA repair disorder caused by methylation of CpG island of MGMT gene promoter are closely related to the occurrence and development of various tumors. Studies have shown that more than 50% of gliomas can have MGMT gene promoter CpG island methylation, and patients with this type of glioma are sensitive to temozolomide chemotherapy, and temozolomide chemotherapy combined with radiotherapy can significantly prolong the survival of patients. Therefore, MGMT gene promoter CpG isla...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6851
CPCC12Q1/6851C12Q1/6886C12Q2600/106C12Q2600/136C12Q2600/154C12Q2600/16C12Q2600/166C12Q2531/113C12Q2545/101C12Q2537/143C12Q2563/107
Inventor 许明炎张晓妮屈宏越
Owner SHENZHEN HAPLOX BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com