Unlock instant, AI-driven research and patent intelligence for your innovation.

Compound screening system targeting ERAD and its application

A compound, lead compound technology, applied in the direction of polypeptides, DNA/RNA fragments, microorganisms, etc. containing localization/targeting motifs

Active Publication Date: 2022-06-14
SUZHOU INST OF SYST MEDICINE
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This system greatly improves the research efficiency of the ERAD reverse transport mechanism, but the drGFP system cannot reflect the accumulation degree of abnormal proteins in the endoplasmic reticulum, which is not conducive to the research of ERAD substrates. In addition, the application of the drGFP system requires proteasome inhibitors. Auxiliary, the increase of influencing factors increases the instability of the system (Zhong Y, Fang S. Live cellimaging of protein dislocation from the endoplasmic reticulum. The Journal of biological chemistry, 2012; 287:28057-66)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compound screening system targeting ERAD and its application
  • Compound screening system targeting ERAD and its application
  • Compound screening system targeting ERAD and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Construction of GFP lentiviral plasmid

[0048]The backbone plasmid is pLVX-AcGFP1-N1-puro, purchased from Fenghui Biotech. The lentiviral plasmid expressing GFP is the original backbone plasmid.

Embodiment 2

[0049] Example 2 Construction of SP-NHK-GFP lentiviral plasmid

[0050] The NHK sequence comes from the plasmid expressing SP-NHK-HA donated by Professor Shengyun Fang of the University of Maryland. Use upstream primer CGGAATTCATGCCGTCTTCTGTCTCGTG, downstream primer: TCCCCCCGGGAATCTGGAACATCGTATGG, SP-NHK-HA plasmid as template, PCR amplify the target fragment, after purification, digest with EcoR-I and XmaI respectively, and digest with T4 ligase and EcoR-I, XmaI The backbone plasmid pLVX-AcGFP1-N11 was ligated overnight at 6 °C. DH5α competent cells were transformed with the connecting plasmid, plated, screened and extracted, and the lentiviral plasmid expressing SP-NHK-GFP was selected by Sanger sequencing.

Embodiment 3

[0051] Example 3 Construction of FLAG-SP-NHK-GFP lentiviral plasmid

[0052] Use upstream primer CGGAATTCATGGATTACAAGGATGACGACGATAAGATGCCGTCTTCTGTCTCGTG, downstream primer: TCCCCCCGGGAATCTGGAACATCGTATGG, SP-NHK-HA plasmid as template, PCR amplify the target fragment, after purification, digest with EcoR-I and XmaI respectively, and digest with T4 ligase and EcoR-I, XmaI The backbone plasmid pLVX-AcGFP1-N11 was ligated overnight at 6 °C. DH5α competent cells were transformed with the connecting plasmid, plated, screened and extracted, and Sanger sequencing was used to select the lentiviral plasmid expressing FLAG-SP-NHK-GFP.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a compound screening system targeting ERAD, comprising a carrier cell expressing a fusion protein in the carrier cell, the fusion protein comprising an α-antitrypsin mutant and a fluorescent protein (NHK), and a nuclear protein encoding the α-antitrypsin mutant The nucleotide sequence includes the sequence shown in SEQ ID No.1. The invention also discloses the application of the above-mentioned drug screening system in the preparation of preparations for detecting compounds targeting ERAD. The present invention constructs a compound screening system targeting ERAD by fusing α-antitrypsin mutants with fluorescent proteins in carrier cells, which can reflect the accumulation of abnormally folded proteins in the endoplasmic reticulum in real time under a fluorescence microscope. The system can be used for high-throughput screening of small molecule lead compounds targeting ERAD and further determination of the compound's role.

Description

technical field [0001] The invention relates to the technical field of ERAD-targeted compound screening, in particular to an ERAD-targeted compound screening system and its application. Background technique [0002] The vigorous growth of tumor cells and the translation of a large number of mutated and overexpressed proteins, most of them will be degraded through the ERAD pathway, and the short peptides produced by the degradation will be presented to the cell surface as tumor antigens. Therefore, the study of ERAD substrates is related to the discovery of tumor neoantigens. Therefore, targeting ERAD has a greater impact on tumor cells and has become a new strategy for anti-tumor. However, ERAD-related research, from substrate discovery to mechanism exploration, currently uses low-efficiency and inaccurate biochemical methods. Therefore, high-throughput screening of small molecule lead compounds targeting ERAD at the cellular level will not only promote ERAD Mechanism rese...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/10C12N15/85C12N15/62C12Q1/02G01N21/64
CPCC07K14/8125C07K14/43595C12N15/85G01N33/5044G01N21/6428C07K2319/02C07K2319/43C12N2800/22
Inventor 刘要甫杨义力
Owner SUZHOU INST OF SYST MEDICINE