Compound screening system targeting ERAD and its application
A compound, lead compound technology, applied in the direction of polypeptides, DNA/RNA fragments, microorganisms, etc. containing localization/targeting motifs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1 Construction of GFP lentiviral plasmid
[0048]The backbone plasmid is pLVX-AcGFP1-N1-puro, purchased from Fenghui Biotech. The lentiviral plasmid expressing GFP is the original backbone plasmid.
Embodiment 2
[0049] Example 2 Construction of SP-NHK-GFP lentiviral plasmid
[0050] The NHK sequence comes from the plasmid expressing SP-NHK-HA donated by Professor Shengyun Fang of the University of Maryland. Use upstream primer CGGAATTCATGCCGTCTTCTGTCTCGTG, downstream primer: TCCCCCCGGGAATCTGGAACATCGTATGG, SP-NHK-HA plasmid as template, PCR amplify the target fragment, after purification, digest with EcoR-I and XmaI respectively, and digest with T4 ligase and EcoR-I, XmaI The backbone plasmid pLVX-AcGFP1-N11 was ligated overnight at 6 °C. DH5α competent cells were transformed with the connecting plasmid, plated, screened and extracted, and the lentiviral plasmid expressing SP-NHK-GFP was selected by Sanger sequencing.
Embodiment 3
[0051] Example 3 Construction of FLAG-SP-NHK-GFP lentiviral plasmid
[0052] Use upstream primer CGGAATTCATGGATTACAAGGATGACGACGATAAGATGCCGTCTTCTGTCTCGTG, downstream primer: TCCCCCCGGGAATCTGGAACATCGTATGG, SP-NHK-HA plasmid as template, PCR amplify the target fragment, after purification, digest with EcoR-I and XmaI respectively, and digest with T4 ligase and EcoR-I, XmaI The backbone plasmid pLVX-AcGFP1-N11 was ligated overnight at 6 °C. DH5α competent cells were transformed with the connecting plasmid, plated, screened and extracted, and Sanger sequencing was used to select the lentiviral plasmid expressing FLAG-SP-NHK-GFP.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


