Supercharge Your Innovation With Domain-Expert AI Agents!

A targeted inhibitor of snord83a gene and its use

An inhibitor and targeted technology, applied in DNA/RNA fragments, genetic engineering, recombinant DNA technology, etc., can solve the problem of unclear application of SNORD83A, and achieve precise targeted therapy effect, low off-target rate and strong specificity. Effect

Active Publication Date: 2022-02-22
SHENGJING HOSPITAL OF CHINA MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the role of SNORD83A in the development of glioblastoma and related mechanisms have not been reported, and the application of SNORD83A in glioblastoma gene therapy is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A targeted inhibitor of snord83a gene and its use
  • A targeted inhibitor of snord83a gene and its use
  • A targeted inhibitor of snord83a gene and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Design of shRNA and preparation of interference vector and application of SNORD83A gene inhibitor.

[0032] 1. Cell culture.

[0033] Human glioblastoma cell lines U87, U251, U373 and human astrocytes (HA) were purchased from the Life Science Cell Resource Center of Shanghai Research Institute. Culture U87, U251, U373, HEK293 and HA cells in 100mm cell culture dish with DMEM high-glucose medium (astrocyte medium AM) containing 10% fetal bovine serum, and replace the medium every 2 days, about Cells can grow to a monolayer in 2-3 days.

[0034] 2. The expression of SNORD83A was detected by real-time quantitative PCR.

[0035] 1. Trizol method to extract total RNA from cells.

[0036] Wash the collected cells with cold PBS, add 1 ml Trizol reagent and pipette several times, observe under the microscope that the cells are in the shape of oil droplets (fully lysed), then transfer to a 1.5 ml EP tube, and let it stand for 5 minutes to fully lyse; add 0.2 ml chl...

Embodiment 2

[0053] Example 2 Application of SNORD83A gene inhibitor significantly inhibits the malignant biological behavior of glioblastoma.

[0054] 1. CCK-8 cell viability assay was used to detect the effect of SNORD83A gene inhibitor on the proliferation ability of glioblastoma cells.

[0055] U87 cells were digested with trypsin, and normal culture medium was used to make single cell suspension. Cells were counted and seeded in 96-well cell culture plates at a concentration of 2000 / well. Five replicate wells were set up in each group, with a total of 200 µl in each well. After 24 hours, 10 µl of CCK-8 was added. After 2 hours, the light absorbance of each well was measured with a microplate reader at a wavelength of 450 nm. CCK-8 cell viability assay After applying the SNORD83A gene inhibitor, the statistical chart of inhibiting the proliferation of U87 cells, such as image 3 shown.

[0056] 2. Transwell cell migration assay to detect the effect of SNORD83A gene inhibitor on the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biomedicine, and specifically relates to a targeted inhibitor of SNORD83A gene and its application. A target inhibitor of SNORD83A gene, the target sequence of the inhibitor is: 5'‑GAATCGGACAGTGTAGAACCA‑3' (SEQ ID No.1). The application of the targeted inhibitor of the SNORD83A gene in the preparation of drugs for treating human brain glioblastoma. The present invention utilizes RNA interference technology to develop a targeted inhibitor of the SNORD83A gene, which can specifically combine with the SNORD83A gene to silence the SNORD83A gene, thereby inhibiting the proliferation, migration and invasion of glioblastoma cells, achieving The purpose of treating glioblastoma. The targeted inhibitor of SNORD83A gene plays an important role in the field of glioblastoma gene therapy, providing new targeted therapeutic drugs for the clinical treatment of glioblastoma.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and specifically relates to a targeted inhibitor of SNORD83A gene and its application. Background technique [0002] Glioblastoma is the most common and most malignant primary central nervous system tumor, characterized by rapid proliferation and high invasion. The median survival time of patients was only 14.4 months. In recent years, in the study of the pathogenesis of glioblastoma, the regulatory role of non-coding RNA on the biological behavior of glioblastoma cells at the transcriptional and post-transcriptional levels has received more and more attention. Therefore, in-depth study of the role and mechanism of non-coding RNA in regulating the biological behavior of glioblastoma cells may provide new targets for the treatment of glioblastoma. [0003] snoRNAs are a class of small non-coding RNAs widely distributed in the nucleolus of eukaryotic cells. They are encoded by introns and hav...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113A61K31/713A61P35/00
CPCC12N15/1135A61K31/713A61P35/00C12N2310/14C12N2310/531
Inventor 刘啸白刘云会王迪薛一雪蔡恒商秀丽郑健杨春清阮雪蕾喻博李振
Owner SHENGJING HOSPITAL OF CHINA MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More