Method for selectively breeding bai2 gene deletion zebra fish through gene knockout
A gene knockout and gene deletion technology, applied in the field of gene knockout, can solve the problems of low efficiency of targeting technology and high off-target rate, and achieve the effect of low cost and simple production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0095] 1) Design CRISPR / Cas9 gene knockout target sites and detection primers respectively
[0096] Query the genomic DNA sequence of the zebrafish bai2 gene on the National Center for Biotechnology Information (NCBI), analyze its functional domain on the website SMART (http: / / smart.embl-heidelberg.de / ), and knock out it according to CRISPR / Cas Principle, design the target site of bai2 gene on the website The ZiFiT Targeter (http: / / zifit.partners.org / ZiFiT / );
[0097] Two pairs of specific target site PCR primers are as follows:
[0098] F1 (target site a forward primer):
[0099] TGTAATACGACTCACTATAggtacggctccttctcgctcGTTTTAGAGCTAGAAATAGC
[0100] F3 (target site b forward primer):
[0101] TGTAATACGACTCACTATAggggaccatacagagttccaGTTTTAGAGCTAGAAATAGC
[0102] R (shared reverse primer): AAGCACCGACTCGGTGCCACT
[0103] PCR detection primers:
[0104] F(5'-tgtctgtgctgtcatccctttt-3')
[0105] R (5'-aagcattcctcaaaccaccggc-3')
[0106] 2) Construction of gRNA expression vecto...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com