Method for selectively breeding bai2 gene deletion zebra fish through gene knockout

A gene knockout and gene deletion technology, applied in the field of gene knockout, can solve the problems of low efficiency of targeting technology and high off-target rate, and achieve the effect of low cost and simple production

Inactive Publication Date: 2019-01-29
HUNAN NORMAL UNIVERSITY
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional gene targeting technology is based on embryonic stem cells (ESC) and homologous recombination technology, so the efficiency of targeting technology is extremely low
At the beginning of 2013, a new artificial endonuclease clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) 9, this technology has the characteristics of simple operation and low cost, and can be more efficient and more accurate in biological Silence specific genes in the whole genome, and can cut multiple sites on the target gene at the same time, silencing any number of single genes, but at the same time, this technology has certain defects, and its off-target rate is relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for selectively breeding bai2 gene deletion zebra fish through gene knockout
  • Method for selectively breeding bai2 gene deletion zebra fish through gene knockout
  • Method for selectively breeding bai2 gene deletion zebra fish through gene knockout

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0095] 1) Design CRISPR / Cas9 gene knockout target sites and detection primers respectively

[0096] Query the genomic DNA sequence of the zebrafish bai2 gene on the National Center for Biotechnology Information (NCBI), analyze its functional domain on the website SMART (http: / / smart.embl-heidelberg.de / ), and knock out it according to CRISPR / Cas Principle, design the target site of bai2 gene on the website The ZiFiT Targeter (http: / / zifit.partners.org / ZiFiT / );

[0097] Two pairs of specific target site PCR primers are as follows:

[0098] F1 (target site a forward primer):

[0099] TGTAATACGACTCACTATAggtacggctccttctcgctcGTTTTAGAGCTAGAAATAGC

[0100] F3 (target site b forward primer):

[0101] TGTAATACGACTCACTATAggggaccatacagagttccaGTTTTAGAGCTAGAAATAGC

[0102] R (shared reverse primer): AAGCACCGACTCGGTGCCACT

[0103] PCR detection primers:

[0104] F(5'-tgtctgtgctgtcatccctttt-3')

[0105] R (5'-aagcattcctcaaaccaccggc-3')

[0106] 2) Construction of gRNA expression vecto...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene knockout, and particularly discloses a method for selectively breeding bai2 gene deletion zebra fish through gene knockout. Through a CRISPR / Cas9 gene editing technique, suitable targeting loci are designed on a bai2 gene of the zebra fish, specific gRNA synthesized in vitro enters a cell of the zebra fish in a micro-coinjection mode, after embryo culture is conducted for 50 h, genotype analysis is conducted by selecting embryos, and thus the effectiveness of the selected loci is verified. According to the method, specific genes can be silenced more efficiently and more precisely in a living body genome, manufacturing is easy, the cost is low, the multiple loci on the target gene can be sheared simultaneously, and the any number of single genes are silenced; and expression of the bai2 gene is interfered, the function of the bai2 gene is studied in a genetics mode, the whole process of cardiac morphology generation and the molecular mechanism of adjusting and controlling the processes are further disclosed advantageously, and the method is of great significance to understanding of pathology of cardiac diseases in medicine and development of new treatment schemes.

Description

technical field [0001] The invention relates to the field of gene knockout, and in particular discloses a method for gene knockout and bai2 gene-deficient zebrafish breeding. Background technique [0002] The bai2 (also known as adgrb2, adhesion G protein-coupled receptor B2) gene is located on chromosome 19 of zebrafish, including 14 exons, and the full-length cDNA is 1904bp. The bai2 gene is expressed in multiple tissues in the early stages of human embryos. In particular, this gene is closely related to the left-right asymmetric development of zebrafish. [0003] The genes and signaling pathways of zebrafish and human heart development are highly homologous, and the bai2 gene is relatively conservative in evolution. Studies have found that bai2 is highly expressed in early zebrafish embryos. Moreover, compared with other animal models, zebrafish has the advantages of small size, easy feeding, fast development, strong reproductive ability, in vitro fertilization, in vitro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/90A01K67/027
CPCA01K67/0276C12N15/113C12N15/902C07K14/461C12N2310/10A01K2217/075A01K2207/15A01K2227/40A01K2267/03C12N2310/20
Inventor邓云欧阳诗谢华平刘乐陈坤
OwnerHUNAN NORMAL UNIVERSITY