Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for producing high-selenium-content protein through yeast fermentation by using exogenous metallothionein

A technology of metallothionein and yeast fermentation, which is applied in the field of using exogenous metallothionein to construct yeast fermentation to produce high-selenoproteins, which can solve the problems of difficult detection of transformants and difficult purification

Inactive Publication Date: 2020-08-14
HENAN UNIVERSITY
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is to overcome the problems in the prior art that the high-efficiency enrichment method of organic selenium in cells is induced by heavy metals or directly expresses the MT gene construction vector in the host, and the induction by heavy metals will cause difficulties in later stage purification, etc. However, direct expression of the MT gene construct vector in the host will face defects such as the difficulty of detecting transformants, and provides a method for using exogenous metallothionein to construct yeast fermentation to produce high selenoproteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0022] A method for using exogenous metallothionein and fusion protein genes to construct vectors to transform yeast genetically engineered bacteria to ferment and produce high-selenoproteins. The starting strain is Saccharomyces cerevisiae. Genetic engineering bacteria are obtained through genetic transformation, and the genetic engineering bacteria are then fermented to produce high selenoproteins;

[0023] Design primer pair YES2-MT2 and primer pair MT2-yes2-F, the sequences of which are as follows:

[0024] YES2-MT2-R: AGCAGTTGGGGTCCATGGATCCGAGCTCGGTACCAAGCTTA

[0025] YES2-MT2-F: GCTGTGCCGACGACGACAAGatGGGTAAGGGAGAAGAACTT

[0026] MT2-yes2-F:GGTACCGAGCTCGGATCCATGGACCCCAACTGCTCCTGTG

[0027] MT2-Yes2-R:TTACCCATCTTGTCGTCGTCGGCACAGCAGCTGCACTTGT

[0028] The primer pair YES2-MT2 is used to reversely amplify the vector sequence with MT2 homology arms, and the primer pair MT2-yes2-F is used to amplify the MT2 fragment. The primer pair YES2-MT2 and the existing EGFP-pGK plasm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing high-selenium-content protein by constructing yeast fermentation by using exogenous metallothionein. Yeast is used as an original strain to design a primer pair YES2-MT2 and a primer pair MT2-yes2-F, genetic transformation is carried out to obtain genetically engineered bacteria, and the genetically engineered bacteria are fermented to produce the high-selenium-content protein. According to the invention, Saccharomyces cerevisiae is used as an original bacterial strain, the genetically engineered bacteria are obtained through exogenous gene genetic transformation, and the genetically engineered bacteria are subjected to fermentation production and separation purification to obtain the high-selenium-content protein. The total efficiency of converting inorganic selenium into selenoprotein reaches up to 22%, and industrial production can be achieved.

Description

technical field [0001] The invention relates to a method for using exogenous metallothionein to construct yeast to ferment and produce high-selenoproteins. Specifically, Saccharomyces cerevisiae is used as the original strain to obtain genetically engineered bacteria through genetic transformation of exogenous genes, and the genetically engineered bacteria are then fermented Produce high selenoproteins. Background technique [0002] Selenium is an essential trace element for living organisms. It has the functions of anti-oxidation, anti-aging, improving immunity, preventing cardiovascular diseases and cancer. However, people in many areas of my country suffer from insufficient selenium nutrition and need to supplement selenium-containing foods. Studies have shown that organic selenium compounds can be better absorbed and utilized by the human body. The organic selenium synthesized by microbial fermentation has the characteristics of rapidity, stability and high efficiency. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/81C12N15/12C12P21/00C12R1/865
CPCC07K14/825C12N15/81C12P21/00
Inventor 马云峰王松廷李华
Owner HENAN UNIVERSITY