Unlock instant, AI-driven research and patent intelligence for your innovation.

A strain of Bacillus pumilus derived from donkey and its application in the preparation of medicine for treating donkey foal diarrhea

A kind of Bacillus pumilus, donkey-derived technology, applied in the direction of drug combination, bacteria, microorganisms, etc., can solve the problem of not growing Bacillus pumilus

Active Publication Date: 2022-03-18
VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI +2
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no known medium that can allow Lactobacillus plantarum to grow under normal conditions without the growth of Bacillus pumilus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A strain of Bacillus pumilus derived from donkey and its application in the preparation of medicine for treating donkey foal diarrhea
  • A strain of Bacillus pumilus derived from donkey and its application in the preparation of medicine for treating donkey foal diarrhea
  • A strain of Bacillus pumilus derived from donkey and its application in the preparation of medicine for treating donkey foal diarrhea

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Isolation of Bacillus pumilus from donkeys Freshly formed feces from healthy donkeys were collected. In the ultra-clean workbench, use a red-hot scalpel to burn the surface of the feces for 2-3 times, cut a small opening, insert a sterile inoculation loop into the feces, inoculate it on the normal nutrient agar medium, and incubate at 37°C for 48 hours . Pick a single colony with white folds on the surface, streak inoculate, and purify 2-3 times. Microscopic examination showed no miscellaneous bacteria, and samples were sent for bacterial identification.

Embodiment 2

[0026] Identification results of Bacillus pumilus

[0027] (1) Colony characteristics: The colonies of Bacillus pumilus are medium in size, white waxy, with irregular, dry, and wrinkled edges. Microscopic features of bacteria: thin rod-shaped bacteria, lateral flagella, endospores, Gram-positive. see picture 1.

[0028] (2) Physiological and biochemical experiments

[0029] Table 1 Biochemical identification results of Bacillus pumilus

[0030]

[0031] (3) 16S rRNA identification results

[0032] The 16S rRNA partial sequence of the strain was amplified with general primers 7F and 1540R, and then sent to Beijing Qingke Xinye Biotechnology Co., Ltd. for sequencing, and the gene sequence with a length of 1426 bp was obtained:

[0033]CTTCCCCCAATCATCTGCCCACCTTCGGCGGCTGGCTCCATAAAGGTTACCTCACCGACT TCGGGTGTTGCAAACTCTCGTGGTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGTAT TCACCGCGGCATGCTGATCCGCGATTACTAGCGATTCCAGCTTCACGCAGTCGAGTTGCA GACTGCGATCCGAACTGAGAACAGATTTGTGGGATTGGCTAAACCTTGCGGTCTCGCAG...

Embodiment 3

[0035] Example 3 Enzyme-producing ability of Bacillus pumilus

[0036] Add 1% casein, 1% sodium carboxymethylcellulose, and 1% soluble starch to the commercially available common nutrient agar medium to prepare three kinds of medium for screening the protease and cellulase production of Bacillus pumilus , Producing amylase performance. Observation through culture revealed that Bacillus pumilus produced protease, but not cellulase and amylase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and in particular relates to a strain of bacillus pumilus derived from donkey and its application in the preparation of medicine for treating donkey foal diarrhea. The present invention provides a strain of Bacillus pumilus isolated from healthy donkey feces, which is further confirmed through 16s rDNA combined with physiological and biochemical identification, and the described Bacillus pumilus is named Bacillus pumilus (Bacillus pumilus); Bacillus has a good effect on the prevention or treatment of donkey diarrhea. Finally, Bacillus pumilus (CGMCC No: 18026) was combined with commercially available Lactobacillus plantarum, citric acid, isomalto-oligosaccharide, and glucose to prepare a compound bacterial agent to treat donkey foal diarrhea, and the effect was remarkable.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to a donkey-derived Bacillus pumilus and its preparation and treatment for donkey foal abdomen [0002] Use of laxatives. Background technique [0003] Donkey foal diarrhea is a common disease, mostly in donkey foals aged 1 to 2 months, mainly manifested as watery diarrhea, dehydration and other symptoms, which can be caused by pathogenic bacteria, viruses, nutritional deficiencies, indigestion and other reasons sick. Escherichia coli diarrhea and diarrhea caused by feeding stress in donkey foals are common. Sensitive antibiotic treatment is effective for E. coli diarrhea but not for feeding stress diarrhea, and antibiotics have the potential risk of leading to bacterial resistance. There is also a method for preventing the disease with bacterial vaccines, but there are many Escherichia coli serotypes, and the effect of bacterial vaccines is difficult to guarantee....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A61K35/742A61K35/747A61K31/702A61K31/7004A61P1/12C12R1/07
CPCC12N1/20A61K35/742A61K35/747A61K31/702A61K31/7004A61P1/12C12R2001/07C12N1/205A61K2300/00
Inventor 张燕张伟黄迪海郭卉齐鹏飞
Owner VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI