Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of pttg3p in preparation of pancreatic cancer diagnostic reagent or kit

A diagnostic kit, pancreatic cancer technology, applied in the field of medical biological detection, to achieve high repeatability, detection sensitivity, and good specificity

Active Publication Date: 2022-05-13
SHANGHAI CHANGHAI HOSPITAL
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are very few studies on PTTG3P
There is no literature report on the application of PTTG3P in the diagnosis of pancreatic cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of pttg3p in preparation of pancreatic cancer diagnostic reagent or kit
  • Application of pttg3p in preparation of pancreatic cancer diagnostic reagent or kit
  • Application of pttg3p in preparation of pancreatic cancer diagnostic reagent or kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Detection of the expression level of PTTG3P in pancreatic cancer and non-cancerous tissues

[0046] 1. Sample collection

[0047] Sixty pairs of pancreatic cancer and paracancerous tissue samples were collected and placed in a -80°C refrigerator. All cases did not receive radiotherapy and chemotherapy before surgery, all patients signed informed consent, and the experimental protocol was approved by the ethics committee of the unit.

[0048] 2. Total RNA extraction

[0049] 1) Take out clinical specimens from the -80°C refrigerator and place them on ice. Weigh 25mg of tissue and place it in a 2ml centrifuge tube, place it on ice, add 1ml Trizol to the centrifuge tube, use a hand-held automatic tissue homogenizer to process until there is no solid component, and let it stand at room temperature for 10 minutes;

[0050] 2) Centrifuge at 13000rpm for 10min at 4°C;

[0051] 3) Pipette the supernatant to a clean RNase-Free 1.5mL centrifuge tube;

[0052] 4) A...

Embodiment 2

[0081] Example 2: Expression of PTTG3P in pancreatic cancer cells

[0082] 1. Cell culture

[0083] Human immortalized pancreatic ductal epithelial cells HPNE, human pancreatic cancer cell lines AsPC-1, BXPC-3, CaPAN-2, MiaPANC-2, PANC-1 and SW1990 were all cultured in DMEM with 10% fetal bovine serum at 37°C, 5 %CO 2 cultured in an incubator.

[0084] 2. RNA extraction

[0085] Discard the medium, wash with PBS twice, add appropriate amount of Trizol, and pipette repeatedly to accelerate cell lysis. All the other steps are the same as in Example 1.

[0086] 3. RT-qPCR

[0087] Concrete steps are with embodiment 1.

[0088] 4. Results

[0089] The result is as figure 2 As shown, compared with pancreatic mucosal epithelial cells, the expression levels of PTTG3P in pancreatic cancer cell lines AsPC-1, BXPC-3, CaPAN-2, MiaPANC-2, PANC-1 and SW1990 were significantly up-regulated, and the difference was statistically significant ( P<0.05 for all).

Embodiment 3

[0090] Example 3: Expression inhibition of PTTG3P

[0091] 1. Cell culture

[0092] Concrete steps are with embodiment 2.

[0093] 2. Design of siRNA

[0094] Use the online siRNA design tool to design two siRNAs for PTTG3P:

[0095] siRNA #1 , CTCAAGTTTCAATATCATGTTTT (SEQ ID NO. 5);

[0096] siRNA #2 , ATCATGTTTTGGCAAAACATTCG (SEQ ID NO. 6).

[0097] 3. Transfection

[0098] Pancreatic cancer cells ASPC-1 were divided into three groups, which were blank control group (transfected with nonsense siRNA), siRNA group #1 (transfection siRNA #1 ) and siRNA group #2 (transfection siRNA #2 ).

[0099] The siRNA concentration was 50nM, and the medium was changed 6 hours after transfection.

[0100] 4. Extraction of total RNA and detection and analysis of PTTG3P expression

[0101] Cell samples were collected after 48 hours, and the subsequent specific steps were the same as in Example 2.

[0102] 5. Results

[0103] The result is as image 3 As shown, compared with the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of medical biological detection, in particular to the application of PTTG3P in the preparation of pancreatic cancer diagnostic reagents or kits. The invention also provides a kit for diagnosing pancreatic cancer by using quantitative PCR detection for PTTG3P, and the application of PTTG3P in the preparation of drugs for treating pancreatic cancer. The kit and detection method of the present invention are simple, reliable, short in cycle, high in specificity, and easy for clinical popularization.

Description

technical field [0001] The invention relates to the technical field of medical biological detection, specifically, the application of PTTG3P in lncRNA in the preparation of pancreatic cancer diagnostic reagents or kits. Background technique [0002] Pancreatic cancer is one of the major disease burdens in my country. At present, the commonly used treatment methods for pancreatic cancer include surgery, radiotherapy, chemotherapy, and targeted therapy, but the above-mentioned treatment methods are still limited for the treatment of advanced pancreatic cancer. [0003] The discovery of the molecular biological basis in the development of pancreatic cancer and the corresponding molecular markers for diagnosis and treatment have important clinical significance. Long non-coding RNA is a kind of non-coding RNA, which is defined as non-coding RNA with a length greater than 200bp. In the past, lncRNA was not paid much attention by researchers, and was considered as "noise" in the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12Q1/6851A61K45/00A61K31/713A61P35/00
CPCC12Q1/6886C12Q1/6851A61K45/00A61K31/713A61P35/00C12Q2600/158C12Q2600/178C12Q2531/113C12Q2521/107C12Q2537/16
Inventor 唐健孔凡扬孔祥毓刘枫杜奕奇李兆申刘文宇张启晨周显祝谢雨婷林金欢
Owner SHANGHAI CHANGHAI HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com