Simulation analysis method of DNA polyhedron with special branch number

A technology of simulation analysis and polyhedron, which is applied in the field of simulation analysis of DNA polyhedron, can solve the problems of inability to judge the influence of DNA polyhedron properties, lack of research on the structure of DNA polyhedron, etc., and achieve the effect of low cost

Active Publication Date: 2020-12-22
SHANDONG UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the previous experimental synthesis or theoretical simulation, the conventional DNA polyhedron structure was designed, that is, a single strand occupies one face of the DNA polyhedron, such as the fou

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Simulation analysis method of DNA polyhedron with special branch number
  • Simulation analysis method of DNA polyhedron with special branch number
  • Simulation analysis method of DNA polyhedron with special branch number

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] (1) Firstly, draw a four-branched DNA tetrahedral link diagram. The number of branches of the DNA tetrahedron is set to 4, the number of intersections on each side is set to 6, the length of the double helix side is set to 31nt, and the length of the linker at the apex is set to 3T. The link graph of DNA polyhedron structure is as follows figure 1 As shown, the whole structure is composed of 4 DNA single strands, and the length of each strand is 3 tetrahedral side lengths, and the DNA tetrahedron is named 4s.

[0069] (2) Use the software uniquimer3D to design the sequence of the DNA polyhedron. The sequence of the DNA polyhedron is as follows, where the underlined part represents the linker:

[0070] strand 1:

[0071] AAACTACTCCTCGAAGTGATTTGTACCGTCT TTT GATAGGGCGGGACCCGG

[0072] GATAGCATATGGGT TTT TGCCCGGATCGAGACCCCTCAATTCGGGAGG

[0073] strand 2:

[0074] ACCCATATGCTATCCCGGGTCCCGCCCTATC TTT ATTTGCGTGATCGCATCACTACCAGACGGAC TTT TAAAAGGGGAATCCCTGCCACGTGAAT...

Embodiment 2

[0087] (1) Firstly, draw a two-branched DNA tetrahedral link graph. The number of branches of the DNA tetrahedron is set to 2, the number of intersections on each side is set to 6, the length of the double helix side is set to 31nt, and the length of the linker at the apex is set to 3T. The link graph of DNA polyhedron structure is as follows figure 1 As shown, the whole structure is composed of 2 DNA single strands, one of which has a length of 3 tetrahedral sides, and the other has a length of 9 tetrahedral sides. The DNA tetrahedron is named 2s1.

[0088] (2) Use the software uniquimer3D to design the sequence of the DNA polyhedron. The sequence of the DNA polyhedron is as follows, where the underlined part represents the linker:

[0089] strand 1:

[0090] ATCGTCTATAGTAAGTTTTTTCCTAACGCAGG TTT TGTTTTCGCGTTACTTTATAGCGGATTTTCA TTT TTGGATCAAATATGAGTAGGTCACGTATCTA TTT TCGGATCCTAGGCTCAGGATCTGGGTATCCA TTT TAGCACATTCAAATCTCCGTTCAGGGGCTCGG TTT TGAAAATCCGCTATAAAGTAACGCGA...

Embodiment 3

[0101] (1) Firstly, draw a two-branched DNA tetrahedral link graph. The number of branches of the DNA tetrahedron is set to 2, the number of intersections on each side is set to 6, the length of the double helix side is set to 31nt, and the length of the linker at the apex is set to 3T. The link graph of DNA polyhedron structure is as follows figure 1 As shown, the whole structure is composed of 2 DNA single strands, one of which has a length of 4 tetrahedral sides, and the other has a length of 8 tetrahedral sides. The DNA tetrahedron is named 2s2.

[0102] (2) Use the software uniquimer3D to design the sequence of the DNA polyhedron. The sequence of the DNA polyhedron is as follows, where the underlined part represents the linker:

[0103] strand 1:

[0104] GGTCGCTGTCGAAAGGCAGTTTCCTAGCAAT TTT TTCGCACGGTGGAGAGTCCGTCTTAACCGCC TTT TGCCGTCCGACTGGATGTTCAGTTCCTCAAAA TTT GCTGTGTAGGTCTGACGCAAAGATCGTACAT TTT ATTGCTAGGAAACTGCCTTTCGACAGCGACC TTT GGGTTTTGCCCTTGTTCAGGCCATGCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a simulation analysis method of a DNA polyhedron with a special branch number, which comprises the following steps of counting the branch number of the DNA polyhedron, drawinga corresponding chain ring diagram, constructing a whole atom model of the DNA polyhedron by using software NanoEnginerer-1, performing molecular dynamics simulation on the DNA polyhedron model by using software NAMD, and analyzing a simulation result by using software Gromacs. The method can be used for judging the stability of the DNA polyhedron with the special branch number and the influence of different topological structures on the property of the DNA polyhedron. The method can be used for judging the stability of the DNA polyhedron with the special branch number, and certain theoreticalsupport is provided for experimental synthesis.

Description

technical field [0001] The invention belongs to the technical field of DNA polyhedron analysis methods, and in particular relates to a simulation analysis method for DNA polyhedrons with special branch numbers. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] In 1869 Miescher discovered nucleic acid. In 1944, Avery proved that DNA is an important genetic material through the transformation experiment of bacteria. In 1953, Watson and Crick proposed the double helix structure model of DNA. Since then, nucleic acid-related research has become one of the most active fields in life science. In 1982, Seeman proposed to use DNA as a structural material to assemble geometrically...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G16B5/00G16B15/00G16B50/00G16C10/00
CPCG16B5/00G16B15/00G16B50/00G16C10/00
Inventor 刘淑雅李佳
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap