A method for efficiently creating mstn gene mutants of Yellow River catfish

A high-efficiency technology of the Yellow River catfish, which is applied in the field of efficiently creating mstn gene mutants of the Yellow River catfish, can solve the problems of opacity of the spawning plate and large individuals, facilitate micromanipulation, increase the mutation rate, and avoid the troubles of hybrid offspring Effect

Active Publication Date: 2022-04-01
INST OF AQUATIC LIFE ACAD SINICA
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for economic fish such as the Yellow River catfish, the individual is large and the spawning plate is opaque, which limits the popularization and application to a certain extent.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] A method for efficiently creating a mstn gene mutant of Yellow River catfish (Silurus lanzhouensis), comprising the steps of:

[0026] 1) Determine the editing target site (GGAAGACGAGGAGGACGACG) of the mstn gene of Yellow River catfish. The gRNA targeting the target site was synthesized with the TranscriptAid T7 High-Yield Transcription Kit (Thermo Fisher Scientific, Waltham, MA). For the synthesis method, refer to the instruction manual. For the synthesis of CAS9 RNA, the pCS2-Cas9 expression plasmid was first linearized with XbaI endonuclease, then purified, and finally synthesized with the mMESSAGE mMAC HINE T7 ULTRA kit (Ambion). For the synthesis method, refer to the instruction manual.

[0027]2) During the breeding season, select the adult Yellow River catfish with a swollen, plump, and soft abdomen as the parent, and use two injections to induce labor: use 5 μg / kg luteinizing releasing hormone for the first injection to induce labor, and after 6-8 hours, use the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of fish genetics and breeding, and specifically discloses a method for efficiently creating mstn gene mutants of Yellow River catfish. This method is aimed at the Yellow River catfish Myostatin‑ Myostatin Gene Design Target Site, Synthetic gRNA, and Cas9 Proteins were co-microinjected into mature eggs of Yellow River catfish (stage V eggs), and then dry insemination was performed with yellow catfish sperm. After hatching and emergence, the mutation efficiency was tested. The knockout efficiency was 80%, and the average mutation efficiency was 74.1%. And the proportion of fully mutant individuals was 24%. Compared with the traditional fish gene editing method, this method not only obtains higher mutation efficiency, but also can efficiently obtain complete mutant individuals of Yellow River catfish, and the combination of gynogenesis increases the homozygosity of mutant individuals. For economic fish with a long reproductive cycle The rapid directional molecular design breeding of species also has important reference value.

Description

technical field [0001] The invention belongs to the field of fish genetics and breeding, and in particular relates to a method for efficiently creating mstn gene mutants of Yellow River catfish. Background technique [0002] Yellow River catfish (Silurus lanzhouensis), also known as Lanzhou catfish, is the name card of aquatic life in the Yellow River. Due to environmental damage and overfishing, the wild population of Yellow River catfish has shrunk sharply, and it has been included in the "Red List of Species in China". At the same time, due to the excellent characteristics of delicious meat, no intermuscular spines and high nutritional value, the Yellow River catfish has become an important economic fish, and the market demand is increasing year by year. However, it takes three years for the Yellow River catfish to reach sexual maturity, resulting in a relatively long genetic breeding cycle. Therefore, it is urgent to establish a set of directional, efficient and rapid ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/89C12N5/10
CPCC12N15/113C12N15/89C07K14/4703C12N2310/20
Inventor 李志李熙银汪洋王忠卫周莉王焘韩笑俞兆曦连总强桂建芳
Owner INST OF AQUATIC LIFE ACAD SINICA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products