A method for efficiently creating mstn gene mutants of Yellow River catfish
A high-efficiency technology of the Yellow River catfish, which is applied in the field of efficiently creating mstn gene mutants of the Yellow River catfish, can solve the problems of opacity of the spawning plate and large individuals, facilitate micromanipulation, increase the mutation rate, and avoid the troubles of hybrid offspring Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0025] A method for efficiently creating a mstn gene mutant of Yellow River catfish (Silurus lanzhouensis), comprising the steps of:
[0026] 1) Determine the editing target site (GGAAGACGAGGAGGACGACG) of the mstn gene of Yellow River catfish. The gRNA targeting the target site was synthesized with the TranscriptAid T7 High-Yield Transcription Kit (Thermo Fisher Scientific, Waltham, MA). For the synthesis method, refer to the instruction manual. For the synthesis of CAS9 RNA, the pCS2-Cas9 expression plasmid was first linearized with XbaI endonuclease, then purified, and finally synthesized with the mMESSAGE mMAC HINE T7 ULTRA kit (Ambion). For the synthesis method, refer to the instruction manual.
[0027]2) During the breeding season, select the adult Yellow River catfish with a swollen, plump, and soft abdomen as the parent, and use two injections to induce labor: use 5 μg / kg luteinizing releasing hormone for the first injection to induce labor, and after 6-8 hours, use the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More