Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CircRNA composition marker for identifying non-small cell lung cancer (NSCLC) subtypes and application of circRNA composition marker

A technology for biomarkers and lung cancer, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of insufficient survival rate, decrease, lack, etc., achieve accurate and reliable results, broad application prospects, The effect of fast diagnosis

Active Publication Date: 2021-02-19
YUANJIAN BIOTECH SHANGHAI CO LTD
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Limited by the lack of high-specificity and sensitivity early screening methods, about 75% of patients have local or distant metastases at the time of diagnosis. Due to the wide range of lesions, middle and advanced lung tumors are often difficult to be cured, and the 5-year survival rate is still insufficient 20%
[0006] In the prior art, the role of circular RNA in the diagnosis and treatment of lung cancer has also been proposed. For example, the Chinese patent No. 202010227453.3 "A Circular RNA and Its Application" shows that by changing the function of circular RNA circ_0058040 The expression has an impact on the proliferation, apoptosis and drug sensitivity of non-small cell lung cancer cells, indicating that reducing the expression of circular RNA circ_0058040 can inhibit the proliferation of non-small cell lung cancer cells and enhance their sensitivity to targeted drugs, but it does not explain which Gene enables accurate detection of lung cancer biomarkers
The patent number is CN202010654555.3 "a diagnostic kit for detecting NSCLC and its use and application", although the hsa_circ_0069841 gene is given as a biomarker for detecting NSCLC, but there is no way to distinguish the specific type of lung cancer. Specifically for NSCLC, squamous cell carcinoma and adenocarcinoma have completely different histological sources, cell growth speed, speed of metastasis, and treatment methods.
Therefore, for patients, there is still a lack of a fast and effective technical means to distinguish squamous cell carcinoma and adenocarcinoma, so that doctors can better formulate treatment plans

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CircRNA composition marker for identifying non-small cell lung cancer (NSCLC) subtypes and application of circRNA composition marker
  • CircRNA composition marker for identifying non-small cell lung cancer (NSCLC) subtypes and application of circRNA composition marker
  • CircRNA composition marker for identifying non-small cell lung cancer (NSCLC) subtypes and application of circRNA composition marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 circRNA gene chip analysis

[0045] Tissues from 8 patients with NSCLC (non-small cell lung cancer) and paired para-cancerous tissues were collected for circRNA gene chip analysis. Different circRNAs were selected based on the standard of log2FC≥1, P Figure 5 shown. From Figure 5 It can be concluded that the most significant difference is hsa_circ_0069841, followed by hsa_circ_001357, and both hsa_circ_0069841 and hsa_circ_001357 are highly expressed in NSCLC tissues.

Embodiment 2

[0047] The expression levels of hsa_circ_0069841 and hsa_circ_001357 in lung cancer paired tissues, bronchial biopsy samples and bronchial brush exfoliated cells were detected by RT-qPCR. Primer sequence:

[0048] Among them, the primer sequence of hsa_circ_0069841

[0049] F:AGACACTGATGGGACTGAGG

[0050] R:GTTGCAAAGCCTCCTCTGTT

[0051] Primer sequence of hsa_circ_001357

[0052] F: GCATTGACCCGTCTCCATC

[0053] R: CCAGGAGCTGCACGATCTTA

[0054] Primer sequence for U6

[0055] F: CTCGCTTCGGCAGCACA

[0056] R: AACGCTTCACGAATTTGCGT

[0057] Receiver operating curve (ROC curve) was drawn to explore the sensitivity and specificity of hsa_circ_0069841 and hsa_circ_001357 alone and in combination in diagnosing NSCLC, and in distinguishing adenocarcinoma from squamous cell carcinoma.

[0058] The specific experiment is as follows:

[0059] ROC curve analysis of surgically resected NSCLC (non-small cell lung cancer) paired tissues, with a sample size of 100 pairs.

[0060] Col...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a circRNA composition marker for diagnosing and identifying non-small cell lung cancer (NSCLC) subtypes and application of the circRNA composition marker, including applicationof hsa_circ_0069841, hsa_circ_001357 and a combination of hsa_circ_001357 and hsa_circ_0069841 in identifying the NSCLC subtypes, and further provides a kit and gene chip prepared from a reagent fordetecting the hsa_circ_0069841, the hsa_circ_001357 and the combination of the hsa_circ_001357 and the hsa_circ_0069841. It is found that the hsa_circ_0069841 and the hsa_circ_001357 can have remarkable specificity and sensitivity to identification of lung adenocarcinoma and lung squamous cell carcinoma in the NSCLC independently or in a combined mode, the diagnosis speed is high, the cost is low,the result is accurate and reliable, rapid and accurate identification of lung cancer subtypes is facilitated through the prepared kit and gene chip, and a reliable basis is provided for targeted therapy of NSCLC patients.

Description

technical field [0001] The invention relates to the technical fields of medicine and clinical diagnosis, in particular to a circular RNA composition marker for identifying subtypes of non-small cell lung cancer and its application. Background technique [0002] Malignant tumors have become a major high-risk disease that seriously threatens human health. The morbidity and mortality of lung cancer rank first among all malignant tumors worldwide. Lung cancer is the most common cancer in my country, and it is the top priority of cancer prevention and treatment. At present, the incidence of lung cancer in my country is increasing by about 26% every year. If effective control measures are not taken in time, it is estimated that by 2025, the number of lung cancer patients in my country will reach 1 million, becoming the world's largest lung cancer country. [0003] Among lung cancers, non-small cell lung cancer (NSCLC) is the most common clinical pathological type of lung cancer,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/113C12N15/11
CPCC12Q1/6886C12Q2600/112C12Q2600/158C12Q2600/166C12Q2600/178
Inventor 杜飞
Owner YUANJIAN BIOTECH SHANGHAI CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products