CircRNA composition marker for identifying non-small cell lung cancer (NSCLC) subtypes and application of circRNA composition marker
A technology for biomarkers and lung cancer, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of insufficient survival rate, decrease, lack, etc., achieve accurate and reliable results, broad application prospects, The effect of fast diagnosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 circRNA gene chip analysis
[0045] Tissues from 8 patients with NSCLC (non-small cell lung cancer) and paired para-cancerous tissues were collected for circRNA gene chip analysis. Different circRNAs were selected based on the standard of log2FC≥1, P Figure 5 shown. From Figure 5 It can be concluded that the most significant difference is hsa_circ_0069841, followed by hsa_circ_001357, and both hsa_circ_0069841 and hsa_circ_001357 are highly expressed in NSCLC tissues.
Embodiment 2
[0047] The expression levels of hsa_circ_0069841 and hsa_circ_001357 in lung cancer paired tissues, bronchial biopsy samples and bronchial brush exfoliated cells were detected by RT-qPCR. Primer sequence:
[0048] Among them, the primer sequence of hsa_circ_0069841
[0049] F:AGACACTGATGGGACTGAGG
[0050] R:GTTGCAAAGCCTCCTCTGTT
[0051] Primer sequence of hsa_circ_001357
[0052] F: GCATTGACCCGTCTCCATC
[0053] R: CCAGGAGCTGCACGATCTTA
[0054] Primer sequence for U6
[0055] F: CTCGCTTCGGCAGCACA
[0056] R: AACGCTTCACGAATTTGCGT
[0057] Receiver operating curve (ROC curve) was drawn to explore the sensitivity and specificity of hsa_circ_0069841 and hsa_circ_001357 alone and in combination in diagnosing NSCLC, and in distinguishing adenocarcinoma from squamous cell carcinoma.
[0058] The specific experiment is as follows:
[0059] ROC curve analysis of surgically resected NSCLC (non-small cell lung cancer) paired tissues, with a sample size of 100 pairs.
[0060] Col...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



