A circular RNA composition marker for distinguishing subtypes of non-small cell lung cancer and its application
A technology for non-small cell lung cancer and adenocarcinoma, applied in the direction of DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of insufficient survival rate, decrease, lack, etc., achieve accurate and reliable results, and have wide application The effect of prospect, diagnosis speed
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1c
[0044] Example 1 analysis of circRNA gene chip
[0045] Tissues from 8 patients with NSCLC (non-small cell lung cancer) and paired para-cancerous tissues were collected for circRNA gene chip analysis. Different circRNAs were selected based on the standard of log2FC≥1, P Figure 5 shown. From Figure 5 It can be concluded that the most significant difference is hsa_circ_0069841, followed by hsa_circ_001357, and both hsa_circ_0069841 and hsa_circ_001357 are highly expressed in NSCLC tissues.
Embodiment 2
[0047] The expression levels of hsa_circ_0069841 and hsa_circ_001357 in lung cancer paired tissues, bronchial biopsy samples and bronchial brush exfoliated cells were detected by RT-qPCR. Primer sequence:
[0048] Among them, the primer sequence of hsa_circ_0069841
[0049] F:AGACACTGATGGGACTGAGG
[0050] R:GTTGCAAAGCCTCCTCTGTT
[0051] Primer sequence of hsa_circ_001357
[0052] F: GCATTGACCCGTCTCCATC
[0053] R: CCAGGAGCTGCACGATCTTA
[0054] Primer sequence for U6
[0055] F: CTCGCTTCGGCAGCACA
[0056] R: AACGCTTCACGAATTTGCGT
[0057] Receiver operating curve (ROC curve) was drawn to explore the sensitivity and specificity of hsa_circ_0069841 and hsa_circ_001357 alone and in combination in diagnosing NSCLC, and in distinguishing adenocarcinoma from squamous cell carcinoma.
[0058] The specific experiment is as follows:
[0059] ROC curve analysis of surgically resected NSCLC (non-small cell lung cancer) paired tissues, with a sample size of 100 pairs.
[0060] Col...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



