Check patentability & draft patents in minutes with Patsnap Eureka AI!

A circular RNA composition marker for distinguishing subtypes of non-small cell lung cancer and its application

A technology for non-small cell lung cancer and adenocarcinoma, applied in the direction of DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of insufficient survival rate, decrease, lack, etc., achieve accurate and reliable results, and have wide application The effect of prospect, diagnosis speed

Active Publication Date: 2021-08-27
YUANJIAN BIOTECH SHANGHAI CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Limited by the lack of high-specificity and sensitivity early screening methods, about 75% of patients have local or distant metastases at the time of diagnosis. Due to the wide range of lesions, middle and advanced lung tumors are often difficult to be cured, and the 5-year survival rate is still insufficient 20%
[0006] In the prior art, the role of circular RNA in the diagnosis and treatment of lung cancer has also been proposed. For example, the Chinese patent No. 202010227453.3 "a circular RNA and its application" shows that by changing the expression of circular RNA circ_0058040 It has effects on the proliferation, apoptosis and drug sensitivity of non-small cell lung cancer cells, indicating that reducing the expression of circular RNA circ_0058040 can inhibit the proliferation of non-small cell lung cancer cells and enhance their sensitivity to targeted drugs, but it does not explain which gene Accurate detection of lung cancer biomarkers
The patent number is CN202010654555.3 "a diagnostic kit for detecting NSCLC and its use and application", although the hsa_circ_0069841 gene is given as a biomarker for detecting NSCLC, but there is no way to distinguish the specific type of lung cancer. Specifically for NSCLC, squamous cell carcinoma and adenocarcinoma have completely different histological sources, cell growth speed, speed of metastasis, and treatment methods. Therefore, for patients, there is still a lack of a fast and effective technical means. To determine whether a patient has squamous cell carcinoma or adenocarcinoma, so that doctors can better formulate treatment plans

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A circular RNA composition marker for distinguishing subtypes of non-small cell lung cancer and its application
  • A circular RNA composition marker for distinguishing subtypes of non-small cell lung cancer and its application
  • A circular RNA composition marker for distinguishing subtypes of non-small cell lung cancer and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1c

[0044] Example 1 analysis of circRNA gene chip

[0045] Tissues from 8 patients with NSCLC (non-small cell lung cancer) and paired para-cancerous tissues were collected for circRNA gene chip analysis. Different circRNAs were selected based on the standard of log2FC≥1, P Figure 5 shown. From Figure 5 It can be concluded that the most significant difference is hsa_circ_0069841, followed by hsa_circ_001357, and both hsa_circ_0069841 and hsa_circ_001357 are highly expressed in NSCLC tissues.

Embodiment 2

[0047] The expression levels of hsa_circ_0069841 and hsa_circ_001357 in lung cancer paired tissues, bronchial biopsy samples and bronchial brush exfoliated cells were detected by RT-qPCR. Primer sequence:

[0048] Among them, the primer sequence of hsa_circ_0069841

[0049] F:AGACACTGATGGGACTGAGG

[0050] R:GTTGCAAAGCCTCCTCTGTT

[0051] Primer sequence of hsa_circ_001357

[0052] F: GCATTGACCCGTCTCCATC

[0053] R: CCAGGAGCTGCACGATCTTA

[0054] Primer sequence for U6

[0055] F: CTCGCTTCGGCAGCACA

[0056] R: AACGCTTCACGAATTTGCGT

[0057] Receiver operating curve (ROC curve) was drawn to explore the sensitivity and specificity of hsa_circ_0069841 and hsa_circ_001357 alone and in combination in diagnosing NSCLC, and in distinguishing adenocarcinoma from squamous cell carcinoma.

[0058] The specific experiment is as follows:

[0059] ROC curve analysis of surgically resected NSCLC (non-small cell lung cancer) paired tissues, with a sample size of 100 pairs.

[0060] Col...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present application discloses a circular RNA composition marker for diagnosing and identifying subtypes of non-small cell lung cancer and its application, including the application of hsa_circ_0069841, hsa_circ_001357 and the combination of hsa_circ_001357 and hsa_circ_0069841 in identifying non-small cell lung cancer subtypes, and also Provided are a kit and a gene chip made by detecting hsa_circ_0069841, hsa_circ_001357 and the reagents combined with hsa_circ_0069841. It is found in the present application that hsa_circ_0069841 and hsa_circ_001357, alone or in combination, have significant specificity and sensitivity for the identification of lung adenocarcinoma and lung squamous cell carcinoma in non-small cell lung cancer, and the diagnosis speed is fast, the cost is low, and the results are accurate and reliable. The kit and gene chip help to identify lung cancer subtypes quickly and accurately, and provide a reliable basis for targeted therapy for patients with non-small cell lung cancer.

Description

technical field [0001] The invention relates to the technical fields of medicine and clinical diagnosis, in particular to a circular RNA composition marker for identifying subtypes of non-small cell lung cancer and its application. Background technique [0002] Malignant tumors have become a major high-risk disease that seriously threatens human health. The morbidity and mortality of lung cancer rank first among all malignant tumors worldwide. [0003] Among lung cancers, non-small cell lung cancer (NSCLC) is the most common clinical pathological type of lung cancer, including squamous cell carcinoma (squamous cell carcinoma), adenocarcinoma, and large cell carcinoma. Compared with small cell carcinoma, its cancer cells grow and divide more slowly , the diffusion transfer is relatively late. It accounts for about 85% of the incidence of lung cancer. Limited by the lack of early screening methods with high specificity and sensitivity, about 75% of patients have local or di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/113C12N15/11
CPCC12Q1/6886C12Q2600/112C12Q2600/158C12Q2600/166C12Q2600/178
Inventor 杜飞
Owner YUANJIAN BIOTECH SHANGHAI CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More