Chimeric antigen receptor and application thereof

A chimeric antigen receptor, single-chain antibody technology, applied in the direction of antibody medical components, carriers, anti-tumor drugs, etc., can solve the problems of high recurrence rate, neurotoxicity, poor persistence, etc.

Pending Publication Date: 2021-02-23
SUNSHINE LAKE PHARM CO LTD
View PDF21 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, chimeric antigen receptor gene-modified T cell therapy (CAR-T) has problems such as high recurrence rate, high cytokine inflammation, poor persistence, and sometimes even neurotoxicity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor and application thereof
  • Chimeric antigen receptor and application thereof
  • Chimeric antigen receptor and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0129] Embodiment 1 chimeric antigen receptor virus packaging

[0130] 1. Synthesis of CARs with different structures. The structures of the constructed CARs with signal peptides are shown in Table 1 below.

[0131] Table 1:

[0132]

[0133] Among them, the amino acid sequence of each part of the CAR structure with the signal peptide and the nucleotide sequence of the corresponding encoding nucleic acid are as follows:

[0134] The nucleotide sequence of the signal peptide (GL) signal peptide:

[0135] Atgggcgtcaaggtcctgttcgccctgatctgcatcgccgtcgccgaggcc

[0136] Amino acid sequence of signal peptide signal peptide (GL):

[0137] MGVKVLFALICIAVAEA

[0138] Nucleotide sequence of CD8 hinge region (hinge):

[0139] ACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGAT

[0140] Amino acid sequence of CD8 hinge region (hinge):

[0141] TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD

[0142] T...

Embodiment 2

[0268] 1. T cell activation and lentivirus infection:

[0269] Take CD3 + Positive cells (viability 98.5%, living cells 5X10 6 ) 2mL, added to a 15mL centrifuge tube containing 5mL AIM-V, centrifuged at 500g for 5min to collect the cells and discard the supernatant, resuspended the cells with 10mL AIM-V medium (containing 20IU / mL IL-2) and transferred to 10cm Culture in a plate, take 180μL CD3 / 28 magnetic beads, add 4mL buffer to wash, put them in the magnetic stand for 2min, remove the supernatant, take 180μL AIM-V medium (containing 20IU / mL of IL-2) and resuspend, Add it to the cell solution, mix well, put it into an incubator for cultivation, and carry out virus transfection after 24 hours of cultivation.

[0270] 2. Take out the cells and place them in a 15mL centrifuge tube, place them in the magnetic stand for 2 minutes, and suck out the cell solution into another clean 15mL centrifuge tube. Take 10 μL of cell liquid, add 10 μL of AO / PI staining solution (staining sol...

Embodiment 3

[0282] Detection of the killing effect of CD 19 CAR-T with different structures

[0283] 1. Cell culture

[0284] The effective target cells (NALM-6 / K562) were cultured in 1640 / IMDM+10% FBS medium, and cultured in a 37°C, 5% carbon dioxide incubator. Suspension cells: Use an inverted microscope to observe the cells once a day, and change the culture medium every 2-4 days. Cell growth density in culture flasks up to 3x10 6 before subculture of cells.

[0285] 2. Treatment of effector cells (CD 19 CAR-T with different structures)

[0286] Collect CAR-T cells with different structures into 15mL centrifuge tubes and centrifuge at 500g for 5min. Discard the supernatant, add 4 mL of 0.01M PBS to wash once, centrifuge to remove the supernatant, and then add an appropriate amount of AIM-V medium to resuspend to keep the density at 10 7 cells / mL or so. Determine cell density and viability.

[0287] 3. Pretreatment of target cells

[0288] 1) Labeling of target cells: Collect ta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a chimeric antigen receptor. The chimeric antigen receptor comprises an extracellular region, a transmembrane region and an intracellular region, wherein the extracellular region comprises a heavy chain variable region, a light chain variable region and a CD8 hinge region of a single-chain antibody, and the single-chain antibody specifically recognizes an antigen; the transmembrane region comprises an immune costimulatory factor transmembrane region; and the intracellular region comprises an immune costimulatory factor intracellular segment and a CD3 zeta chain. According to the embodiment of the invention, the chimeric antigen receptor can specifically recognize tumor cells expressing specific antigens and realize specific killing of the tumor cells highly expressing the specific antigens.

Description

technical field [0001] The present invention relates to the field of biomedicine, specifically, the present invention relates to chimeric antigen receptors and applications thereof, more specifically, the present invention relates to chimeric antigen receptors, transgenic lymphocytes expressing said chimeric antigen receptors, and constructs , a lentivirus, a method for preparing the transgenic lymphocyte, a therapeutic composition for treating cancer, and a method for improving the safety, effectiveness or durability of lymphocyte therapy. Background technique [0002] Tumors can avoid immune surveillance by inducing the expression of immunosuppressive receptors, which are turned off by tumor cells from the immune response. Chimeric antigen receptor T cells (CAR-T cells) are a chimeric protein expressed on T cells by coupling the variable region of an antibody that can recognize a certain tumor antigen with a co-stimulatory structure and CD3 protein, which can specifically ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/867C12N7/01C12N5/10A61K39/00A61P35/00C12R1/93
CPCC07K16/2803C07K14/7051C12N5/0636C12N15/86C12N7/00A61P35/00C12N2740/15043C12N2740/15021C07K2317/622C07K2319/03C07K2319/02C12N2510/00C12N2800/107A61K2239/28A61K39/4611A61K39/4631A61K39/464412A61K39/464402C07K16/28A61K2039/545A61K2039/572C07K2319/33C12N2740/16043A61K48/005C07K14/70517C07K14/70578C07K14/7151C07K2317/53
Inventor陈超董军纪于婷婷曾怡徐乐王旭昉李志广李少燕叶群瑞陈小锋李文佳
OwnerSUNSHINE LAKE PHARM CO LTD