Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A closed-tube rapid visual detection kit for Salmonella and its detection method

A detection kit and Salmonella technology, applied in the field of molecular biology, can solve the problems of easy pollution of LAMP and no better solution, and achieve the effects of rapid method, triple anti-pollution and improved accuracy

Active Publication Date: 2021-04-23
北京睿博奥科技有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are more and more studies on the influence of nanomaterials on nucleic acid amplification technology, but there is no relevant literature reporting the influence of nanomaterials on the amplification efficiency of LAMP
And there is no better solution to the problem of easy contamination of LAMP than paying attention to the operating environment and primer design

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A closed-tube rapid visual detection kit for Salmonella and its detection method
  • A closed-tube rapid visual detection kit for Salmonella and its detection method
  • A closed-tube rapid visual detection kit for Salmonella and its detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1 Extraction of Salmonella genome.

[0068] The template DNA of Salmonella CVCC542 was extracted according to Quanshijin Co., Ltd. Bacterial Genomic DNA Extraction Kit, and electrophoresed through agarose gel ( figure 1 ) and nanodrop to determine the quality of the extracted genomes (Table 1).

[0069] Table 1 Salmonella genome content

[0070] sample 1 2 3 4 5 6 7 8 9 10 ng 57 41 38 40 45 43 36 50 64 21

Embodiment 2

[0071] Example 2 Synthesis of nano gold.

[0072] All glass containers synthesized by nano-gold were soaked in 5% dichlorosilane in chloroform solution for several minutes for siliconization treatment, then rinsed with distilled water and dried for later use. Take 1mL of 1wt% HAuCl4, 190mL of distilled water, and 9mL of 1wt% citric acid solution and boil them in a round bottom flask. A JEM-1400 Plus, Jeol Ltd., Tokyo, Japan transmission electron microscopy characterization of synthesized gold nanoparticles ( figure 2 ).

[0073] The results show that the synthesized gold nanoparticles are uniformly dispersed, and the particle size is about 17 nm. According to the absorbance and Lambert Beer's law, the concentration of gold nanoparticles is 5 nM.

Embodiment 3

[0074] Example 3 LAMP reaction optimization.

[0075] LAMP amplification system includes inv A-F3, inv A-B3, inv A-FIP, inv A-BIP, dNTPs, MgSO 4 , BstDNA polymerase, 10×Isothermal Buffer, betaine, gold nanoparticles, H2O. The primer sequences of the LAMP amplification system are shown in Table 2, and the LAMP amplification system is shown in Table 3.

[0076] Table 2 Primer sequences

[0077] name length Sequence (5'-3') inv A-F3 19-mer (F3:19-mer) GCGAAGCGTACTGGAAAGG inv A-B3 19-mer (B3:19-mer) TCAACAATGCGGGGATCTG inv A-FIP 42-mer (F1c: 22-mer F2: 20-mer) ATGATGCCGGCAATAGCGTCACAAAGCCAGCTTTACGGTTCC inv A-BIP 39-mer (B1c:20-mer B2:19-mer) GTGGGGATGACTCGCCATGGACCATCACCAATGGTCAGC

[0078] Table 3 LAMP reaction system

[0079] Composition of reaction system add volume final concentration 10×Isothermal Buffer 2.5 μL 1× 10 μM inv A-FIP / inv A-BIP 4.0 μL 1.6 μM 10 μM inv A-F3 / inv A-B3 0.5 μL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a Salmonella closed-tube fast visual detection kit and a detection method thereof. The Salmonella rapid detection kit includes the following components: integrated tube, nano-gold enhanced LAMP amplification system, and related reagents for negative staining detection. The invention combines nano-gold-enhanced LAMP constant temperature amplification and negative staining visualization technology to realize closed-tube detection of Salmonella, and has the characteristics of triple anti-pollution, rapidity, strong specificity, high sensitivity, and visualization.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a rapid visual detection kit for closed-tube Salmonella and a detection method thereof. Background technique [0002] Salmonella is a Gram-negative, facultative anaerobic microorganism. The optimum growth temperature is 37°C. It can multiply in large numbers above 20°C, and can survive for 3 to 4 months under low temperature conditions. It is the most common food-borne pathogenic bacteria, often exists in the intestinal tract of humans and animals, and is a zoonotic pathogen. According to statistics, Salmonella ranks first in bacterial food poisoning in my country's inland areas. At present, the gold standard for Salmonella detection is the detection of biochemical characteristics, that is, fermentation of glucose, maltose, mannitol and sorbitol to produce gas; no fermentation of lactose and sucrose; no production of indole, negative V-P reaction; no hydrolysis of urea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/10C12N15/11C12R1/42
CPCC12Q1/6844C12Q1/689C12Q2531/119C12Q2547/101C12Q2547/107C12Q2563/137C12Q2563/155
Inventor 许文涛杜再慧林晟豪李佳乐
Owner 北京睿博奥科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com