A closed-tube rapid visual detection kit for Salmonella and its detection method
A detection kit and Salmonella technology, applied in the field of molecular biology, can solve the problems of easy pollution of LAMP and no better solution, and achieve the effects of rapid method, triple anti-pollution and improved accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Example 1 Extraction of Salmonella genome.
[0068] The template DNA of Salmonella CVCC542 was extracted according to Quanshijin Co., Ltd. Bacterial Genomic DNA Extraction Kit, and electrophoresed through agarose gel ( figure 1 ) and nanodrop to determine the quality of the extracted genomes (Table 1).
[0069] Table 1 Salmonella genome content
[0070] sample 1 2 3 4 5 6 7 8 9 10 ng 57 41 38 40 45 43 36 50 64 21
Embodiment 2
[0071] Example 2 Synthesis of nano gold.
[0072] All glass containers synthesized by nano-gold were soaked in 5% dichlorosilane in chloroform solution for several minutes for siliconization treatment, then rinsed with distilled water and dried for later use. Take 1mL of 1wt% HAuCl4, 190mL of distilled water, and 9mL of 1wt% citric acid solution and boil them in a round bottom flask. A JEM-1400 Plus, Jeol Ltd., Tokyo, Japan transmission electron microscopy characterization of synthesized gold nanoparticles ( figure 2 ).
[0073] The results show that the synthesized gold nanoparticles are uniformly dispersed, and the particle size is about 17 nm. According to the absorbance and Lambert Beer's law, the concentration of gold nanoparticles is 5 nM.
Embodiment 3
[0074] Example 3 LAMP reaction optimization.
[0075] LAMP amplification system includes inv A-F3, inv A-B3, inv A-FIP, inv A-BIP, dNTPs, MgSO 4 , BstDNA polymerase, 10×Isothermal Buffer, betaine, gold nanoparticles, H2O. The primer sequences of the LAMP amplification system are shown in Table 2, and the LAMP amplification system is shown in Table 3.
[0076] Table 2 Primer sequences
[0077] name length Sequence (5'-3') inv A-F3 19-mer (F3:19-mer) GCGAAGCGTACTGGAAAGG inv A-B3 19-mer (B3:19-mer) TCAACAATGCGGGGATCTG inv A-FIP 42-mer (F1c: 22-mer F2: 20-mer) ATGATGCCGGCAATAGCGTCACAAAGCCAGCTTTACGGTTCC inv A-BIP 39-mer (B1c:20-mer B2:19-mer) GTGGGGATGACTCGCCATGGACCATCACCAATGGTCAGC
[0078] Table 3 LAMP reaction system
[0079] Composition of reaction system add volume final concentration 10×Isothermal Buffer 2.5 μL 1× 10 μM inv A-FIP / inv A-BIP 4.0 μL 1.6 μM 10 μM inv A-F3 / inv A-B3 0.5 μL...
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



