Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant vibrio natriegens and application thereof

A technology of sodium-requiring Vibrio and glycerol dehydratase, applied in recombinant sodium-requiring Vibrio and its application field, and can solve the problems of inhibiting bacterial production performance, lowering, complicated post-extraction process and the like

Active Publication Date: 2021-04-09
TSINGHUA UNIV +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main disadvantages of the current glycerol production 1,3-propanediol process route are: (1) commonly used 1,3-propanediol production strains such as Klebsiella pneumoniae are conditional pathogenic bacteria, and biosafety requirements are required in the production process. Strict control; (2) The synthesis of a large number of by-products such as acetic acid, lactic acid, succinic acid, and 2,3-butanediol makes the entire post-extraction process very complicated; (3) Crude glycerin contains high concentrations of NaCl, It will inhibit the production performance of the bacteria, thereby reducing the production of 1,3-propanediol using crude glycerol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Construction of embodiment 1 expression plasmid

[0062] 1. Construction of 1,3-propanediol synthesis module expression plasmid

[0063] Glycerol dehydratase gene dhaBCE (amino acid sequence shown in SEQ ID NO.1-3, nucleotide sequence shown in SEQ ID NO.15), glycerol dehydratase activator gene orfXY (amino acid sequence shown in SEQ ID NO.4- 5, nucleotide sequence as shown in SEQ ID NO.16) and alcohol dehydrogenase gene yqhD (amino acid sequence as shown in SEQ ID NO.6, nucleotide sequence as shown in SEQ ID NO.17) connected To the expression plasmid, construct the plasmid pTrc99a-PDO containing the synthesis module of glycerol conversion to 1,3-propanediol, the specific method is as follows:

[0064] 分别以dhaBCE-F(5'-aagcggcatgcatttacgttttgacggctagctcagtcctag gtacagtgctagcttcaccttttgagccgatgaacaatgaa-3')和dhaBCE-R(5'-cgcaccaggataacgctagcactgtacctaggactgagctagccgtcaattaattcgcctgaccggccag-3'),orfXY-F(5'-cagtcctaggtacagtgctagcgttatcctggtgcgggagagaatgatgaacaagagccaacaagttca-...

Embodiment 2

[0072] Example 2 Knocking out the arcA gene to improve the yield and yield of 1,3-propanediol produced by Narophilicus

[0073] 1. Knock out the arcA gene

[0074] Knockout the transcriptional regulator gene arcA (the amino acid sequence is shown in SEQ ID NO.11, and the nucleotide sequence is shown in SEQ ID NO.20) in Narophilus ATCC 14048. The arcA gene knockout method is as follows:

[0075] ArcA-up-F (5'-ccgaatagtctgaaccgttacgacc-3'), arcA-up-R (5'-gacagcttatcactgatcagggcggtacctaaatttgtgacaaaatt-3') and arcA-down-F (5'-aagcagctccagcctacacgtgcgctactgcacttctgtga-3') and arcA-down -R(5'-acgctttgtgacctcttgct-3') was used as a primer, and a 3.0 kb PCR fragment was respectively amplified with Narophilus ATCC 14048 as a template. Using arcA-kana-F (5'-gtcacaaatttaggtaccgccctgatcagtgataagctgtcaaacatgag-3') and arcA-kana-R (5'-cacagaagtgcagtagcgcacgtgtaggctggagctgcttc-3') as primers, a 1.3 kb PCR was amplified using plasmid pSIJ8 (purchased from Addgene) as a template fragment. ...

Embodiment 3

[0086] Example 3 Knocking out the GlpR gene to increase the yield and yield of 1,3-propanediol produced by Narophilicus

[0087] 1. Knockout the transcriptional regulator gene glpR in Narophilus ATCC 14048 and VN△arcA respectively

[0088] The glpR gene knockout method is as follows:

[0089] With glpR-up-F (5'-cggtcatccaggataaagctacagc-3'), glpR-up-R (5'-cgaagcagctccagcctacactttcggtattctcggaatcagtgg-3') and glpR-down-F (5'-tttgacagcttatcactgatcagttaggactccatgtgcacggg-3') and glpR-down -R (5'-cttactccccccctttaatagagccc-3') was used as a primer, and the 3.0kb glpR gene (amino acid sequence shown in SEQ ID NO.12, nucleotide sequence As shown in SEQ ID NO.21) upstream and downstream fragments. Using glpR-kana-F (5'-ccactgattccgagaataccgaaagtgtaggctggagctgcttc-3') and glpR-kana-R (5'-ctacccgtgcacaatggagtcctaactgatcagtgataagctgtcaaacatga ga-3') as primers, the plasmid pSIJ8 (purchased from Addgene) was used as template to amplify the 1.3 kb PCR fragments. The three fragments we...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to recombinant vibrio natriegens and application thereof. The invention provides the recombinant vibrio natriegens which expresses glycerol dehydratase, a glycerol dehydratase activator and alcohol dehydrogenase, and compared with wild type vibrio natriegens, the recombinant vibrio natriegens has the advantages that the expression and / or enzyme activity of a transcription regulation factor is reduced, and the transcription regulation factor is arcA and / or glpR. According to the method, vibrio natriegens is modified, so that glycerol fermentation can be efficiently utilized to produce 1, 3-propylene glycol, the yield of 1, 3-propylene glycol is high, byproducts are few, and the extraction and separation process is simple; and moreover, the vibrio natriegens is used for solving the potential biosafety problem of the traditional 1, 3-propylene glycol production strain and the problem of low tolerance of the strain to salt in crude glycerine, and has important industrial application value.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant natrigovibrio and application thereof. Background technique [0002] 1,3-Propanediol is an important chemical raw material, which can be used as an organic solvent in ink, printing and dyeing, paint, lubricant, antifreeze and other industries. Its main use is as a monomer for the synthesis of polyester and polyurethane. Especially polymerized with terephthalic acid to form polytrimethylene terephthalate (PTT). Compared with PET (polyethylene terephthalate) and PBT (polybutylene terephthalate), PTT has better properties, such as better pollution resistance, toughness and resilience, and Ultraviolet properties, etc., in addition, it also has the advantages of wear resistance, low water absorption, and low static electricity. Therefore, PTT is considered as an upgraded product of PET and has broad market prospects. [0003] At present, the production method of 1,3-propa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/60C12N15/53C12N15/31C12N9/88C12N9/04C07K14/26C07K14/28C12P7/18C12R1/63
CPCC12N9/88C12N9/0006C07K14/26C07K14/28C12P7/18C12Y402/0103C12Y101/01008
Inventor 陈振张冶刘德华
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com