New coronavirus antigen and preparation method and application thereof
A fusion protein and protein technology, applied in the fields of biology and medicine, can solve problems such as reducing the sensitivity of detection reagents and failing to effectively detect antibodies.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: A new coronavirus antigen and its preparation method and application
[0026] Preparation of fusion protein S1-HSA:
[0027] The Spike gene was purchased from Nanjing GenScript Biotechnology Co., Ltd. (article number: C0425FA280-6), and the HSA gene was entrusted to Suzhou Jinweizhi Biological Company to prepare it through gene synthesis. Design synthetic primers as follows:
[0028] S-F0:ACCCAAGCTTgccaccATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGTTCCTCACAGTGCGTCAATCTG;
[0029] S1-R1:
[0030] CCTCGCTCTTGTGGGCGTCACCTCCTGGCGCGCCCGCGGCTCTTCTGGGAGAGTTTG;
[0031] HSA-F1:
[0032] CCAGAAGAGCCGCGGGCGCGCCAGGAGGTGACGCCCACAAGAGCGAGGTGGCCC;
[0033] HSA-R2: ATCTGCAGAATTCCCAGGCCCAGGGCGGCCTGGCTG;
[0034] Using the Spike gene as a template and S-F0 / S1-R1 as primers, amplify the S1 gene fragment. Amplification conditions: 94°C, 5min; (94°C, 30s; 55°C, 30s; 72°C, 1min)x30; 72°C, 5min. Amplification system: 10×buffer (including Mg 2+ ), 5ul; 2.5mM...
Embodiment 2
[0089] Example 2: A new coronavirus antigen and its preparation method and application
[0090] A fusion protein comprising a Spike protein S1 domain part and an HSA part, wherein in the Spike protein S1 domain part corresponding to the 685th arginine of the Spike protein is replaced by glycine.
[0091] The preferred technical solution is: the structure of the fusion protein is S1-HSA or HSA-S1, wherein "-" represents a chemical bond or a linker.
[0092] The preferred technical solution is: the amino acid sequence of the S1 domain of the Spike protein is SEQ ID No:1.
[0093] The preferred technical solution is: the amino acid sequence of the fusion protein is SEQ ID No:2.
[0094] To achieve the above purpose and other related purposes, the technical solution provided by the present invention is: a nucleotide encoding a fusion protein, the sequence of which is SEQ ID No:3.
[0095] A recombinant vector, comprising the above-mentioned nucleotides.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com