New coronavirus antigen and preparation method and application thereof

A fusion protein and protein technology, applied in the fields of biology and medicine, can solve problems such as reducing the sensitivity of detection reagents and failing to effectively detect antibodies.

Pending Publication Date: 2021-06-04
思格(苏州)生物科技有限公司
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Most of the antigens used in the common SARS-CoV-2 antibody detection kits on the market are aimed at the RBD domain of the Spike protein, and the NTD domain is a highly glycosylated part, which is more immunogenic than the RBD segment and more It is easy to stimulate the production of antibodies in vivo, so the RBD domain as an anti-principle cannot effectively detect antibodies against NTD, reducing the sensitivity of detection reagents

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New coronavirus antigen and preparation method and application thereof
  • New coronavirus antigen and preparation method and application thereof
  • New coronavirus antigen and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: A new coronavirus antigen and its preparation method and application

[0026] Preparation of fusion protein S1-HSA:

[0027] The Spike gene was purchased from Nanjing GenScript Biotechnology Co., Ltd. (article number: C0425FA280-6), and the HSA gene was entrusted to Suzhou Jinweizhi Biological Company to prepare it through gene synthesis. Design synthetic primers as follows:

[0028] S-F0:ACCCAAGCTTgccaccATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACCGGTTCCTCACAGTGCGTCAATCTG;

[0029] S1-R1:

[0030] CCTCGCTCTTGTGGGCGTCACCTCCTGGCGCGCCCGCGGCTCTTCTGGGAGAGTTTG;

[0031] HSA-F1:

[0032] CCAGAAGAGCCGCGGGCGCGCCAGGAGGTGACGCCCACAAGAGCGAGGTGGCCC;

[0033] HSA-R2: ATCTGCAGAATTCCCAGGCCCAGGGCGGCCTGGCTG;

[0034] Using the Spike gene as a template and S-F0 / S1-R1 as primers, amplify the S1 gene fragment. Amplification conditions: 94°C, 5min; (94°C, 30s; 55°C, 30s; 72°C, 1min)x30; 72°C, 5min. Amplification system: 10×buffer (including Mg 2+ ), 5ul; 2.5mM...

Embodiment 2

[0089] Example 2: A new coronavirus antigen and its preparation method and application

[0090] A fusion protein comprising a Spike protein S1 domain part and an HSA part, wherein in the Spike protein S1 domain part corresponding to the 685th arginine of the Spike protein is replaced by glycine.

[0091] The preferred technical solution is: the structure of the fusion protein is S1-HSA or HSA-S1, wherein "-" represents a chemical bond or a linker.

[0092] The preferred technical solution is: the amino acid sequence of the S1 domain of the Spike protein is SEQ ID No:1.

[0093] The preferred technical solution is: the amino acid sequence of the fusion protein is SEQ ID No:2.

[0094] To achieve the above purpose and other related purposes, the technical solution provided by the present invention is: a nucleotide encoding a fusion protein, the sequence of which is SEQ ID No:3.

[0095] A recombinant vector, comprising the above-mentioned nucleotides.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a new coronavirus antigen and a preparation method and application thereof. The new coronavirus antigen comprises a fusion protein, wherein the fusion protein comprises a Spike protein S1 structural domain part and an HSA part, and the 685 arginine corresponding to Spike protein in the Spike protein S1 structural domain part is replaced with glycine. The prepared fusion protein serves as a key antigen component in a new coronavirus serum antibody detection kit and is used for detecting a new coronavirus antibody; and the fusion protein serves as a vaccine to be given to animals or human to generate antibodies and is used for preventing new coronavirus. The fusion protein serves as a therapeutic drug to be given to new coronavirus patients and is used for treating new coronavirus pneumonia.

Description

technical field [0001] The invention belongs to the fields of biology and medicine, and relates to a new coronavirus antigen and its preparation method and application. Background technique [0002] The new coronavirus (SARS-CoV-2) belongs to Betacoronavirus (Betacoronavirus) in classification, which is a single-stranded positive-sense RNA virus. It is adjacent to the group of SARS virus and SARS-like (SARS-like) virus in the position of evolutionary tree. The main manifestations of the disease are fever, dry cough, and fatigue, often accompanied by shortness of breath and dyspnea. In severe cases, COVID-19 can lead to severe acute respiratory distress syndrome, septic shock, functional failure and even death. The structure of coronavirus mainly includes spike protein (Spike, S), membrane protein (Envelope), nucleocapsid (Nucleocapsid, N) and envelope protein (Membrance, M). The S protein forms a special corolla structure on the surface of the virus in the form of a trimer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62A61K39/215A61P31/14G01N33/569
CPCC07K14/005A61K39/12A61P31/14G01N33/56983C12N2770/20022C12N2770/20034C07K2319/31G01N2333/165G01N2469/20
Inventor 任宝永刘鹏
Owner 思格(苏州)生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap