Detection method and kit for noninvasive antenatal fetal chromosome aneuploidy
A detection kit and detection method technology, applied in the biological field, can solve problems such as difficult to meet the difficult requirements of NIPT
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1. A non-invasive method for detecting fetal chromosomal aneuploidy
[0039] This example mainly describes a non-invasive method for detecting aneuploidy of prenatal fetal chromosomes. The detection method comprises the following processing steps:
[0040] 1. Sample processing
[0041] The peripheral blood sample was centrifuged at 1600g for 10 minutes at 4°C, and the plasma part was centrifuged at 16000g for 10 minutes at 4°C to further remove residual blood cells.
[0042] 2. DNA extraction
[0043] Cell-free DNA was extracted from plasma using the QIAamp Circulating Nucleic Acid Extraction Kit (Manufacturer: QIAGEN; catalog number: 55114) following the manufacturer's instructions.
[0044] 3. Reagent preparation:
[0045] Prepare the digital PCR reaction solution (1 reaction) according to the recipe in Table 1:
[0046] Table 1. Digital PCR reaction solution
[0047] components volume 10×dPCR Buffer 3.5 μL enzyme 1.0 μL Pr...
Embodiment 2
[0086] Example 2. A non-invasive method for detecting fetal chromosomal aneuploidy
[0087] This example mainly describes a non-invasive method for detecting aneuploidy of prenatal fetal chromosomes. The difference from Example 1 is that on the basis of the primer sequences used in Example 1, double the primers are added, and the design method of the new primers is mainly to include all the primer sequences in Example 1. CCTGGGGGAGTATTGCGGAGGAAGG (SEQ ID NO. 181) was all replaced by ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT (SEQ ID NO. 182), and the remaining processing parameters were the same as in Example 1.
[0088] The method described in this example was applied to the detection of 269 cases of clinical samples. The experimental results showed that the positive test result value was significantly higher than the negative sample value, and the two groups of data can be distinguished very ...
Embodiment 3
[0090] Example 3. A non-invasive method for detecting fetal chromosomal aneuploidy
[0091] This example mainly describes a non-invasive method for detecting aneuploidy of prenatal fetal chromosomes. The difference from Example 1 is that on the basis of the primer sequences used in Example 1, double the primers are added, and the design method of the new primers is mainly to include all the primer sequences in Example 1. CCTGGGGGAGTATTGCGGAGGAAGG (SEQ ID NO.181) was all replaced with GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCAACCC (SEQ ID NO.183), and the remaining processing parameters were the same as in Example 1. The method described in this example was applied to the detection of 269 cases of clinical samples. The experimental results showed that the positive test result value was significantly higher than the negative sample value, and the two groups of data can be distinguished very well, and are better than Example 1 the experimental results. It is proved that the method de...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


