Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection method and kit for noninvasive antenatal fetal chromosome aneuploidy

A detection kit and detection method technology, applied in the biological field, can solve problems such as difficult to meet the difficult requirements of NIPT

Pending Publication Date: 2021-06-04
NANJING PREGENE BIOTECHNOLOGY CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, it is difficult for current PCR techniques to meet the difficult requirements of NIPT detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method and kit for noninvasive antenatal fetal chromosome aneuploidy
  • Detection method and kit for noninvasive antenatal fetal chromosome aneuploidy
  • Detection method and kit for noninvasive antenatal fetal chromosome aneuploidy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1. A non-invasive method for detecting fetal chromosomal aneuploidy

[0039] This example mainly describes a non-invasive method for detecting aneuploidy of prenatal fetal chromosomes. The detection method comprises the following processing steps:

[0040] 1. Sample processing

[0041] The peripheral blood sample was centrifuged at 1600g for 10 minutes at 4°C, and the plasma part was centrifuged at 16000g for 10 minutes at 4°C to further remove residual blood cells.

[0042] 2. DNA extraction

[0043] Cell-free DNA was extracted from plasma using the QIAamp Circulating Nucleic Acid Extraction Kit (Manufacturer: QIAGEN; catalog number: 55114) following the manufacturer's instructions.

[0044] 3. Reagent preparation:

[0045] Prepare the digital PCR reaction solution (1 reaction) according to the recipe in Table 1:

[0046] Table 1. Digital PCR reaction solution

[0047] components volume 10×dPCR Buffer 3.5 μL enzyme 1.0 μL Pr...

Embodiment 2

[0086] Example 2. A non-invasive method for detecting fetal chromosomal aneuploidy

[0087] This example mainly describes a non-invasive method for detecting aneuploidy of prenatal fetal chromosomes. The difference from Example 1 is that on the basis of the primer sequences used in Example 1, double the primers are added, and the design method of the new primers is mainly to include all the primer sequences in Example 1. CCTGGGGGAGTATTGCGGAGGAAGG (SEQ ID NO. 181) was all replaced by ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT (SEQ ID NO. 182), and the remaining processing parameters were the same as in Example 1.

[0088] The method described in this example was applied to the detection of 269 cases of clinical samples. The experimental results showed that the positive test result value was significantly higher than the negative sample value, and the two groups of data can be distinguished very ...

Embodiment 3

[0090] Example 3. A non-invasive method for detecting fetal chromosomal aneuploidy

[0091] This example mainly describes a non-invasive method for detecting aneuploidy of prenatal fetal chromosomes. The difference from Example 1 is that on the basis of the primer sequences used in Example 1, double the primers are added, and the design method of the new primers is mainly to include all the primer sequences in Example 1. CCTGGGGGAGTATTGCGGAGGAAGG (SEQ ID NO.181) was all replaced with GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCAACCC (SEQ ID NO.183), and the remaining processing parameters were the same as in Example 1. The method described in this example was applied to the detection of 269 cases of clinical samples. The experimental results showed that the positive test result value was significantly higher than the negative sample value, and the two groups of data can be distinguished very well, and are better than Example 1 the experimental results. It is proved that the method de...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection method and kit for noninvasive prenatal fetal chromosome aneuploidy. The detection method comprises the following steps: extracting fetal free DNA in peripheral blood of a pregnant woman, and amplifying the extracted fetal free DNA by using digital PCR, wherein a primer used in the digital PCR comprises a three-dimensional structure, a reaction solution used in the digital PCR does not comprise a cytosine triphosphate deoxynucleotide component, the primer used in the digital PCR comprises a three-dimensional structure, the primer used in the digital PCR comprises a special nucleic acid sequence with not less than 13 basic groups, and the special nucleic acid sequence is only composed of adenine, guanine and thymine. According to the detection method for the noninvasive prenatal fetal chromosome aneuploidy, a special buffer solution and unique primer design are applied, and a digital PCR technical means is adopted to detect whether chromosome aneuploidy exists in fetal DNA (specifically referring to free fetal DNA in peripheral blood of a mother).

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to a non-invasive detection method and kit for prenatal fetal chromosome aneuploidy. Background technique [0002] Prenatal detection of fetal chromosomal aneuploidy is mainly carried out through Down's screening based on serological detection. Pregnant women with high risk can also obtain cells by amniocentesis, and then use cell biology methods for karyotype According to the analysis, this procedure is regarded as the gold standard, but because of its invasiveness, there is a certain risk of intrauterine infection, premature delivery and miscarriage in pregnant women, which limits its wide application in clinical practice. In addition, cytogenetic diagnosis also has disadvantages such as time-consuming, difficult culture, and inability to detect minor chromosomal structural aberrations. Therefore, non-invasive prenatal diagnosis technology (NIPT) based on high-thr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/686
CPCC12Q1/6883C12Q1/686C12Q2600/156C12Q2563/159
Inventor 尚午王友祥杨志劼张毅良
Owner NANJING PREGENE BIOTECHNOLOGY CO LTD