Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of transcription factor zhx2 in NK cell regulation

A technology of NK cells and transcription factors, applied in the field of functional genomics and biomedicine

Active Publication Date: 2022-07-29
SHANDONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the inventors found that the specific function of ZHX2 for the regulation of NK cell function has not been reported, and it belongs to a new protein with unknown function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of transcription factor zhx2 in NK cell regulation
  • Application of transcription factor zhx2 in NK cell regulation
  • Application of transcription factor zhx2 in NK cell regulation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0091] 1. ZHX2 overexpression plasmid synthesis and vector construction.

[0092] The RNA of NK92 cells was extracted with Trizol reagent from Tiangen Company, and cDNA was obtained by reverse transcription with the reverse transcription kit from Thermo Company. Amplify the full-length cDNA of ZHX2 using the high-fidelity Taq enzyme of Thermo Company, primer sequences: ZHX2-F: gaagatctgccaccatggctagcaaacgaaaatcta (SEQ ID NO. 1); ZHX2-R: CGacgcgtCTAAGCGTAGTCTGGTACGTCGT (SEQ ID NO. 2), the primer tag is HA-tag , located at the C-terminus of the protein. After the PCR product was recovered by gel, the full-length fragment was excised by restriction enzymes BglII and MluI. After gel recovery, the product was ligated to the pcDNA3.0-HA vector. After sequencing and verification, the ZHX2 gene overexpression vector was obtained. pcDNA3.0-ZHX2-HA, the sequence is shown in the figure ( figure 1 ).

[0093] 2. Western blot identification of the expression of ZHX2 expression vector in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the application of transcription factor ZHX2 in the regulation of NK cells, and belongs to the technical fields of functional genomics and biomedicine. The present invention confirms through research that ZHX2 gene can inhibit the killing function of NK cells by down-regulating the expression of the important activating receptor NKG2D on the surface of NK cells, inhibiting the degranulation ability of NK cells and the secretion of cytokines. Therefore, it can be used for gene diagnosis and gene therapy of human autoimmune diseases and tumors, and can also be used for the design and development of new drugs for the ZHX2 gene. Therefore, it has good practical application value.

Description

technical field [0001] The invention belongs to the technical field of functional genomics and biomedicine, and particularly relates to the application of transcription factor ZHX2 in the regulation of NK cells. Background technique [0002] The information disclosed in this Background section is only for enhancement of understanding of the general background of the invention and should not necessarily be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person of ordinary skill in the art. [0003] Natural killer (NK) cells are an important part of the innate immune system and serve as the body's first line of defense against cancer and viruses. Activated NK cells can not only kill tumors and virus-infected cells through the killing function, but also regulate the specific and non-specific immunity of other immune cells by secreting cytokines. As a bridge connecting innate immunity and adaptive immunity, the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/0783C12N15/113C12N15/867C12N5/10A61P35/00A61P37/02
CPCC12N5/0646C12N15/113C12N15/86C07K14/4702A61P35/00A61P37/02C12N2310/14C12N2310/531C12N2501/24C12N2501/25C12N2501/734C12N2740/15043C12N2510/00C12N2501/998
Inventor 马春红谭思雨高丽芬梁晓红王体潇郭小维武专昌李春阳
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More