Application of transcription factor ZHX2 in the regulation of NK cells
A technology of NK cells and transcription factors, applied in the fields of functional genomics and biomedicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0092] 1. ZHX2 overexpression plasmid synthesis and vector construction.
[0093] The RNA of NK92 cells was extracted using Trizol reagent from Tiangen Company, and cDNA was obtained by reverse transcription with the reverse transcription kit from Thermo Company. Use Thermo's high-fidelity Taq enzyme to amplify ZHX2 full-length cDNA, primer sequence: ZHX2-F: gaagatctgccaccatggctagcaaacgaaaatcta (SEQ ID NO.1); ZHX2-R: CGacgcgtCTAAGCGTAGTCTGGTACGTCGT (SEQ ID NO.2), primer label is HA-tag , located at the C-terminus of the protein. After the gel recovery of the PCR product, the full-length fragment was excised by restriction endonucleases BglII and MluI, and after gel recovery, the product was connected to the pcDNA3.0-HA vector, and after sequencing verification, the ZHX2 gene overexpression vector was obtained pcDNA3.0-ZHX2-HA, the sequence is shown in the figure ( figure 1 ).
[0094] 2. Western blot to identify the expression of ZHX2 expression vector in HEK293.
[0095] ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com