Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of transcription factor ZHX2 in the regulation of NK cells

A technology of NK cells and transcription factors, applied in the fields of functional genomics and biomedicine

Active Publication Date: 2021-06-15
SHANDONG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the inventors found that the specific function of ZHX2 for the regulation of NK cell function has not been reported, and it belongs to a new protein with unknown function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of transcription factor ZHX2 in the regulation of NK cells
  • Application of transcription factor ZHX2 in the regulation of NK cells
  • Application of transcription factor ZHX2 in the regulation of NK cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0092] 1. ZHX2 overexpression plasmid synthesis and vector construction.

[0093] The RNA of NK92 cells was extracted using Trizol reagent from Tiangen Company, and cDNA was obtained by reverse transcription with the reverse transcription kit from Thermo Company. Use Thermo's high-fidelity Taq enzyme to amplify ZHX2 full-length cDNA, primer sequence: ZHX2-F: gaagatctgccaccatggctagcaaacgaaaatcta (SEQ ID NO.1); ZHX2-R: CGacgcgtCTAAGCGTAGTCTGGTACGTCGT (SEQ ID NO.2), primer label is HA-tag , located at the C-terminus of the protein. After the gel recovery of the PCR product, the full-length fragment was excised by restriction endonucleases BglII and MluI, and after gel recovery, the product was connected to the pcDNA3.0-HA vector, and after sequencing verification, the ZHX2 gene overexpression vector was obtained pcDNA3.0-ZHX2-HA, the sequence is shown in the figure ( figure 1 ).

[0094] 2. Western blot to identify the expression of ZHX2 expression vector in HEK293.

[0095] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a transcription factor ZHX2 in the regulation of NK cells, and belongs to the technical field of functional genomics and biological medicine. Researches prove that the ZHX2 gene can inhibit the degranulation capability of the NK cells and the secretion of cell factors by down-regulating the expression of an important activated receptor NKG2D on the surfaces of the NK cells so as to inhibit the killing function of the NK cells. Therefore, the ZHX2 gene can be used for gene diagnosis and gene therapy of human autoimmune diseases and tumors, and new drug design and development can be carried out aiming at the ZHX2 gene. Therefore, the ZHX2 gene has good practical application value.

Description

technical field [0001] The invention belongs to the technical fields of functional genomics and biomedicine, and specifically relates to the application of transcription factor ZHX2 in the regulation of NK cells. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] Natural killer (NK) cells are an important part of the innate immune system and serve as the body's first line of defense against cancer and viruses. Activated NK cells can not only kill tumors and virus-infected cells through their killing function, but also regulate the specific and non-specific immunity of other immune cells by secreting cytokines and other methods. As a bridge connecting innate immunity and ada...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/0783C12N15/113C12N15/867C12N5/10A61P35/00A61P37/02
CPCC12N5/0646C12N15/113C12N15/86C07K14/4702A61P35/00A61P37/02C12N2310/14C12N2310/531C12N2501/24C12N2501/25C12N2501/734C12N2740/15043C12N2510/00C12N2501/998
Inventor 马春红谭思雨高丽芬梁晓红王体潇郭小维武专昌李春阳
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com