Recombinant bacillus subtilis with improved production stability of N-acetylneuraminic acid

A Bacillus subtilis, N-terminal technology, applied in the field of Bacillus subtilis metabolic engineering and genetic engineering, can solve problems such as reducing adaptability, restricting the industrial application of biological processes, reducing the production stability of microbial cell factories, etc., to achieve the effect of increasing stability

Pending Publication Date: 2021-06-15
JIANGNAN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Producer cells often show reduced adaptability due to production burden. Therefore, non-producer cells with more growth advantages will gradually replace production cells during the fermentation process, thereby occupying the entire bioreactor and reducing the production stability of microbial cell factories. Limits the industrial application of many biological processes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus subtilis with improved production stability of N-acetylneuraminic acid
  • Recombinant bacillus subtilis with improved production stability of N-acetylneuraminic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The construction of embodiment 1 double output subpopulation regulation plasmid

[0041] (1) Using the subgroup regulatory loop 1.1 plasmid (sourced from publication number: CN112342234A) as a template, using fp-1.1-9.8k-f and fp-1.1-9.8k-r as primers, PCR amplifies the linearized subgroup regulatory loop 1.1 plasmid;

[0042] fp-1.1-9.8k-f: cagctcaaaaaaactgtttatctgtaagctgcaaggcgattaagttgggta;

[0043] fp-1.1-9.8k-r:agcgtattacggagcacttcccatactttcgccagctggcgtaatag;

[0044] (2) Using the subgroup regulatory circuit 1.3 plasmid (sourced from publication number: CN112342234A) as a template, using ftsW-1.6k-f and ftsW-1.6k-r as primers, PCR amplification obtained including P veg105 , RBS 0 , N-terminal coding sequence N 1 and a fragment of the essential gene ftsW;

[0045] ftsW-1.6k-f: tatgggaagtgctccgtaatacgct;

[0046] tsW-1.6k-r:ttacagataaacagtttttttgagctgtttctttttcattcc;

[0047] The above two fragments were purified and recovered, and connected using the Gibson A...

Embodiment 2

[0049] Example 2 Constructing a knockout frame for knocking out essential gene copies on the genome

[0050] 1. Construct the fol knockout box

[0051] (1) Using primers qc-folB-1.2k-1f and qc-folB-1.2k-1r to perform colony PCR on wild-type Bacillus subtilis (Bacillus subtilis) 168, amplify to obtain fol1 fragment;

[0052] qc-folB-1.2k-1f:agctagaagctctcttgacagct;

[0053] qc-folB-1.2k-1r: gtttcctgtgtgaaattgttatccgctcttgcttaaatccagctcagcggt;

[0054] (2) Using the plasmid P7Z6 (such as SEQ ID NO.12) as a template, and using 3p7s6-1.3f and 3p7s6-1.3r as primers, obtain the fol2 fragment by PCR amplification;

[0055] 3p7s6-1.3f: gagcggataacaatttcacacaggaaac;

[0056] 3p7s6-1.3r: taacgccagggttttcccagtc;

[0057] (3) Using qc-folB-1.2k-3f and qc-folB-1.2k-3r as primers, perform colony PCR on wild-type Bacillus subtilis 168, and amplify to obtain the fol3 fragment;

[0058] qc-folB-1.2k-3f: gactgggaaaaccctggcgttaaccttgagcaaacgatcaactatgct;

[0059] qc-folB-1.2k-3r: ctcccgcat...

Embodiment 3

[0063] Example 3 Production Stability Analysis of Recombinant Bacillus subtilis NeuAc

[0064] First, the cell subgroup regulatory loop 1.1 plasmid was transferred into Bacillus subtilis BgG-N abrB-30bp (the BgG-NabrB-30bp construction method was disclosed in the paper "Synthetic N-terminal coding sequences for fine-tuning gene expression and metabolic engineering in Bacillus subtilis ", and named as recombinant Bacillus subtilis No.1 in subsequent experiments), then use the fol knockout frame constructed in Example 2 to knock out the folB copy of the essential gene on the genome to construct recombinant Bacillus subtilis No. 2;

[0065] First, the cell subgroup regulatory circuit 1.3 plasmid was transferred into the recombinant Bacillus subtilis No.1, and then the ftsW knockout frame obtained in Example 2 was used to knock out the copy of the essential gene ftsW on the genome to construct the recombinant Bacillus subtilis No. 3;

[0066] First, the double-output subgroup re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant bacillus subtilis with improved production stability of N-acetylneuraminic acid, and belongs to the technical field of bacillus subtilis metabolic engineering and genetic engineering. According to the invention, two single-output cell subgroup regulation loops are combined to construct a dual-output subgroup regulation loop capable of improving the stability of the subgroup regulation loop. In the double-output subgroup regulation loop, two sensor promoters Pveg105 are used as output promoters, and the cell subgroup regulation loop can fail only when the two sensor promoters Pveg105 are subjected to genetic mutation at the same time, so that the stability of the subgroup regulation loop is improved. The obtained recombinant bacillus subtilis can maintain NeuAc production all the time in the continuous passage fermentation culture process of 96 hours, and the yield is stabilized at 0.65-0.90 g / L.

Description

technical field [0001] The invention relates to a recombinant bacillus subtilis with improved production stability of N-acetylneuraminic acid, which belongs to the technical field of metabolic engineering and genetic engineering of bacillus subtilis. Background technique [0002] At present, microbial cell factories can be used to produce a variety of target compounds on a laboratory scale, but there are few biological processes that can be commercially applied. In the process of scaling up from a small laboratory test to an industrial production scale, due to genetic heterogeneity caused by genetic mutations, phenotypic heterogeneity caused by complex regulation, and environmental heterogeneity that is difficult to control during the fermentation process, a Production populations developed from monoclonal cells exist in the presence of production and non-production cells during fermentation. Producer cells often show reduced adaptability due to production burden. Therefore...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/75C12N15/60C12N15/54C12N1/21C12P19/26C12R1/125
CPCC12N15/75C12N9/88C12N9/1051C12P19/26C12Y401/02025C12Y204/01129
Inventor刘延峰堵国成曹燕亭刘龙吕雪芹李江华陈坚
OwnerJIANGNAN UNIV