Gene and application of novel coronavirus b.1.525 Nigerian mutant strain rbd
A technology of coronavirus and mutant strains, applied in the direction of viruses, applications, viral peptides, etc., can solve problems such as antibody neutralization and escape
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Optimizing the RBD sequence of the wild-type novel coronavirus B.1.525 Nigerian mutant strain
[0041] On the basis of the wild-type novel coronavirus RBD amino acid sequence, the following optimization was performed to obtain the initially optimized RBD nucleotide sequence of the novel coronavirus B.1.525 Nigerian mutant strain:
[0042] The present invention optimizes the codons encoding the amino acid sequence in the coding sequence according to the genetic codon bias of Chinese hamster CHO cells;
[0043] Among them, according to the codon preference, the laboratory's previous experience in high-efficiency protein expression, mRNA secondary structure and other factors, the optimized SEQ ID NO.1 was obtained:
[0044] AGAGTGCAGCCAACAGAGAGCATCGTGAGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCAACAAGGTTCGCCAGCGTGTACGCCTGGAACAGAAAAAGGATCAGCAACTGCGTGGCAGACTACAGTGTGCTGTACAACTCCGCCTCCTTCTCCACCTTCAAATGCTATGGCGTGTCCCCCACCAAGCTGAACGATCTGTGTTTTACCAACGTGTACGCCGACTCC...
Embodiment 2
[0062] Example 2 Expression and purification of recombinant RBD protein
[0063]The complete target gene shown in SEQ ID NO.6 is subjected to Nhel / Notl double enzyme digestion, and then connected to the pcDNA3.1+ eukaryotic expression vector through the same enzyme digestion to obtain a recombinant vector. The plasmid structure is as follows: figure 1 shown.
[0064] The recombinant vectors were transformed into Escherichia coli respectively, and the plasmids were amplified according to conventional methods, and then the plasmids were extracted with a kit from Tiangen Biological Co., Ltd.
[0065] Transfect Chinese hamster CHO cells: prepare according to the Lipofectin kit manual to obtain a DNA-liposome mixture, add it to Chinese hamster CHO cells cultured in DMEM medium, and incubate at 37°C for 2 hours; replace the medium with DMEM containing 10% FBS Medium, continue to culture for 48h.
[0066] Screening of Neomycin-resistant clones: Separate the transfected cells from ...
Embodiment 3
[0077] Example 3 Mouse Immunization Experiment
[0078] Twenty 6- to 8-week-old female BALB / c mice were randomly divided into the following groups:
[0079] Immunization group 1 (10 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used was 10 μg RBD+100 μg Al(OH) 3 , wherein, RBD is the novel coronavirus B.1.525 Nigerian mutant strain RBD glycoprotein expressed by the CHO cells prepared in Example 2, containing 10 μg RBD and 100 μg Al(OH) in a volume of 100 μL 3 Compatible vaccines with saline.
[0080] Immunization group 2 (5 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used was 5 μg RBD+100 μg Al(OH) 3 , wherein, wherein, RBD is the novel coronavirus B.1.525 Nigeria mutant strain RBD glycoprotein expressed by the CHO cells prepared in Example 2, containing 5 μg RBD and 100 μg Al(OH) in a volume of 100 μL 3 Compatible vaccines with saline.
[0...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



