Novel coronavirus Brazilian strain p. 1 The gene of mutant rbd and its application
A technology of coronavirus and mutant strains, applied in the direction of viruses, applications, viral peptides, etc., can solve problems affecting the ability of antibodies to recognize and neutralize viruses
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1 Optimizing wild-type novel coronavirus Brazilian strain P. 1 Mutant RBD sequence
[0051] On the basis of the wild-type novel coronavirus RBD amino acid sequence, the following optimization was performed to obtain a preliminary optimized novel coronavirus Brazilian strain P. 1 Mutant RBD nucleotide sequence:
[0052] According to the genetic codon preference of Chinese hamsters, the present invention optimizes the codons encoding the amino acid sequence in the coding sequence, and obtains three candidate optimized sequences in total.
[0053] According to the codon preference, the laboratory's previous high-efficiency protein expression experience, mRNA secondary structure and other factors, the optimized SEQ ID NO.1 was obtained:
[0054] AGAGTGCAGCCAACAGAGAGCATCGTGAGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCAACAAGGTTCGCCAGCGTGTACGCCTGGAACAGAAAAAGGATCAGCAACTGCGTGGCAGACTACAGTGTGCTGTACAACTCCGCCTCCTTCTCCACCTTCAAATGCTATGGCGTGTCCCCCACCAAGCTGAACGATCTGTGTTTT...
Embodiment 2
[0071] Expression and purification of embodiment 2 recombinant RBD protein
[0072] The complete target gene shown in SEQ ID NO.6 (its electrophoresis result is as follows figure 1 shown), the gene was subjected to Nhel / Notl double digestion, and then connected to the pcDNA3.1+ eukaryotic expression vector that had undergone the same digestion to obtain a recombinant vector;
[0073] The recombinant vectors were transformed into Escherichia coli respectively, and the plasmids were amplified according to conventional methods, and then the plasmids were extracted with a kit from Tiangen Biological Co., Ltd.
[0074] Transfect Chinese hamster CHO cells: prepare according to the Lipofectin kit manual to obtain a DNA-liposome mixture, add it to Chinese hamster CHO cells cultured in DMEM medium, and incubate at 37°C for 2 hours; replace the medium with DMEM containing 10% FBS Medium, continue to culture for 48h.
[0075] Screening of Neomycin-resistant clones: Separate the transf...
Embodiment 3
[0089] Embodiment 3 mouse immunization experiment
[0090] Twenty 6- to 8-week-old female BALB / c mice were randomly divided into the following groups:
[0091] Immunization group 1 (10 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used is 10 μg RBD+100 μg Al(OH) 3 , wherein, RBD is the new coronavirus Brazilian strain P. 1 mutant RBD glycoprotein. Contains 10 μg RBD and 100 μg Al(OH) in a 100 μL volume 3 Compatible vaccines with saline.
[0092] Immunization group 2 (5 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used was 5 μg RBD+100 μg Al(OH) 3 , wherein, wherein, RBD is the new coronavirus Brazilian strain P. 1 Mutant RBD glycoprotein containing 5 μg RBD and 100 μg Al(OH) in a volume of 100 μL 3 Compatible vaccines with saline.
[0093] Adjuvant control group: intramuscularly inject 100 μL of vaccine on day 0 and 14 respectively, the ad...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


