Unlock instant, AI-driven research and patent intelligence for your innovation.

Novel coronavirus Brazilian strain p. 1 The gene of mutant rbd and its application

A technology of coronavirus and mutant strains, applied in the direction of viruses, applications, viral peptides, etc., can solve problems affecting the ability of antibodies to recognize and neutralize viruses

Active Publication Date: 2021-10-15
BIO-BANK CORP
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

P. 1 The combination of K417T, E484K, and N501Y in the RBD region of the mutant can cause a huge change in the conformation of the RBD, which may cause P. 1 Infectious and antigenic changes that affect the ability of antibodies produced by natural infection or vaccination to recognize and neutralize the virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel coronavirus Brazilian strain p.  1 The gene of mutant rbd and its application
  • Novel coronavirus Brazilian strain p.  1 The gene of mutant rbd and its application
  • Novel coronavirus Brazilian strain p.  1 The gene of mutant rbd and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 Optimizing wild-type novel coronavirus Brazilian strain P. 1 Mutant RBD sequence

[0051] On the basis of the wild-type novel coronavirus RBD amino acid sequence, the following optimization was performed to obtain a preliminary optimized novel coronavirus Brazilian strain P. 1 Mutant RBD nucleotide sequence:

[0052] According to the genetic codon preference of Chinese hamsters, the present invention optimizes the codons encoding the amino acid sequence in the coding sequence, and obtains three candidate optimized sequences in total.

[0053] According to the codon preference, the laboratory's previous high-efficiency protein expression experience, mRNA secondary structure and other factors, the optimized SEQ ID NO.1 was obtained:

[0054] AGAGTGCAGCCAACAGAGAGCATCGTGAGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCAACAAGGTTCGCCAGCGTGTACGCCTGGAACAGAAAAAGGATCAGCAACTGCGTGGCAGACTACAGTGTGCTGTACAACTCCGCCTCCTTCTCCACCTTCAAATGCTATGGCGTGTCCCCCACCAAGCTGAACGATCTGTGTTTT...

Embodiment 2

[0071] Expression and purification of embodiment 2 recombinant RBD protein

[0072] The complete target gene shown in SEQ ID NO.6 (its electrophoresis result is as follows figure 1 shown), the gene was subjected to Nhel / Notl double digestion, and then connected to the pcDNA3.1+ eukaryotic expression vector that had undergone the same digestion to obtain a recombinant vector;

[0073] The recombinant vectors were transformed into Escherichia coli respectively, and the plasmids were amplified according to conventional methods, and then the plasmids were extracted with a kit from Tiangen Biological Co., Ltd.

[0074] Transfect Chinese hamster CHO cells: prepare according to the Lipofectin kit manual to obtain a DNA-liposome mixture, add it to Chinese hamster CHO cells cultured in DMEM medium, and incubate at 37°C for 2 hours; replace the medium with DMEM containing 10% FBS Medium, continue to culture for 48h.

[0075] Screening of Neomycin-resistant clones: Separate the transf...

Embodiment 3

[0089] Embodiment 3 mouse immunization experiment

[0090] Twenty 6- to 8-week-old female BALB / c mice were randomly divided into the following groups:

[0091] Immunization group 1 (10 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used is 10 μg RBD+100 μg Al(OH) 3 , wherein, RBD is the new coronavirus Brazilian strain P. 1 mutant RBD glycoprotein. Contains 10 μg RBD and 100 μg Al(OH) in a 100 μL volume 3 Compatible vaccines with saline.

[0092] Immunization group 2 (5 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used was 5 μg RBD+100 μg Al(OH) 3 , wherein, wherein, RBD is the new coronavirus Brazilian strain P. 1 Mutant RBD glycoprotein containing 5 μg RBD and 100 μg Al(OH) in a volume of 100 μL 3 Compatible vaccines with saline.

[0093] Adjuvant control group: intramuscularly inject 100 μL of vaccine on day 0 and 14 respectively, the ad...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biotechnology, in particular to a novel coronavirus Brazilian strain P. 1 Mutant RBD gene and its application. The novel coronavirus Brazilian strain P. 1 The RBD gene of the mutant strain, its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.6. The present invention optimizes wild-type novel coronavirus Brazilian strain P. 1 The gene sequence of the mutant strain RBD was combined with screening to determine the relative best sequence, and the clone expression efficiency of the optimized sequence was higher than that of the wild-type novel coronavirus Brazilian strain P. 1 The expression efficiency of the RBD sequence of the mutant strain is greatly improved, so that the Brazilian strain of the novel coronavirus P. 1 The gene of the mutant RBD is more conducive to the preparation of a new coronavirus vaccine to deal with the infection of the Brazilian mutant strain of the new coronavirus.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a novel coronavirus Brazilian strain P. 1 Mutant RBD gene and its application. Background technique [0002] The new coronavirus (Severe acute respiratory syndrome coronavirus 2, SARS-CoV-2), which was discovered at the end of 2019, caused the new coronavirus pneumonia COVID-19. It is the seventh known coronavirus that can infect humans, and the remaining six are respectively These are HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV causing Severe Acute Respiratory Syndrome, and MERS-CoV causing Middle East Respiratory Syndrome. [0003] Coronaviruses are a class of RNA viruses with an envelope and a linear single-stranded positive strand genome. They are a large class of viruses that exist widely in nature. Coronavirus particles are irregular in shape, enveloped, round or oval in shape, with a diameter of about 60-220nm. There are three types of glycoproteins on the membrane...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/50C12N15/85C12N5/10C07K14/165A61K39/215A61P31/14
CPCA61K39/12A61P31/14C07K14/005C12N15/85C12N2770/20022C12N2770/20034C12N2800/22
Inventor 赵兴卉翟俊辉杜红王轲珑
Owner BIO-BANK CORP