Novel coronavirus b. 1.1.7 The gene of British mutant rbd and its application
A coronavirus and mutant technology, applied in the direction of viruses, applications, viral peptides, etc., can solve problems such as affecting vaccine effects and immune escape
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1 Optimizing wild-type novel coronavirus B. 1.1.7 RBD sequence of British mutant strain
[0050] On the basis of the wild-type novel coronavirus RBD amino acid sequence, the following optimization was performed to obtain a preliminary optimized novel coronavirus B. 1.1.7 Nucleotide sequence of RBD of British mutant strain:
[0051] According to the bias of Chinese hamster genetic codons, the present invention optimizes the codons encoding the amino acid sequence in the coding sequence, and obtains 3 candidate optimized sequences in total.
[0052] According to the codon preference, the laboratory's previous high-efficiency protein expression experience, mRNA secondary structure and other factors, the optimized SEQ ID NO.1 was obtained:
[0053]AGAGTGCAGCCAACAGAGAGCATCGTGAGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCAACAAGGTTCGCCAGCGTGTACGCCTGGAACAGAAAAAGGATCAGCAACTGCGTGGCAGACTACAGTGTGCTGTACAACTCCGCCTCCTTCTCCACCTTCAAATGCTATGGCGTGTCCCCCACCAAGCTGAACGATCTGTGTT...
Embodiment 2
[0069] Expression and purification of embodiment 2 recombinant RBD protein
[0070] The complete target gene shown in SEQ ID NO.6 (its electrophoresis result is as follows figure 1 shown), the gene was subjected to Nhel / Notl double digestion, and then connected to the pcDNA3.1+ eukaryotic expression vector that had undergone the same digestion to obtain a recombinant vector;
[0071] The recombinant vectors were transformed into Escherichia coli respectively, and the plasmids were amplified according to conventional methods, and then the plasmids were extracted with a kit from Tiangen Biological Co., Ltd.
[0072] Transfect Chinese hamster CHO cells: prepare according to the Lipofectin kit manual to obtain a DNA-liposome mixture, add it to Chinese hamster CHO cells cultured in DMEM medium, and incubate at 37°C for 2 hours; replace the medium with DMEM containing 10% FBS Medium, continue to culture for 48h.
[0073] Screening of Neomycin-resistant clones: Separate the transf...
Embodiment 3
[0087] Embodiment 3 mouse immunization experiment
[0088] Twenty 6- to 8-week-old female BALB / c mice were randomly divided into the following groups:
[0089] Immunization group 1 (10 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used is 10 μg RBD+100 μg Al(OH) 3 , wherein, RBD is the new coronavirus expressed by the CHO cells prepared in Example 2. British B. 1.1.7 Mutant RBD glycoprotein. Contains 10 μg RBD and 100 μg Al(OH) in a 100 μL volume 3 Compatible vaccines with saline.
[0090] Immunization group 2 (5 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used was 5 μg RBD+100 μg Al(OH) 3 , wherein, wherein, RBD is the new coronavirus expressed by the CHO cells prepared in Example 2. British B. 1.1.7 Mutant RBD glycoprotein, containing 5 μg RBD and 100 μg Al(OH) in 100 μL volume 3 Compatible vaccines with saline.
[0091] Adjuvant contro...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com