Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene of novel corona virus diease-2019 B.1.525 Nigera mutant strain RBD and application of gene

A technology of coronavirus and mutant strains, applied in the direction of applications, viruses, and viral peptides, can solve problems such as antibody neutralization and escape

Active Publication Date: 2021-07-06
BIO-BANK CORP
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

All of these mutations may lead to antibody neutralization escape
The remaining mutations in orf1a may increase replication efficiency, or result in escape from antibody neutralization, or both

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene of novel corona virus diease-2019 B.1.525 Nigera mutant strain RBD and application of gene
  • Gene of novel corona virus diease-2019 B.1.525 Nigera mutant strain RBD and application of gene
  • Gene of novel corona virus diease-2019 B.1.525 Nigera mutant strain RBD and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Optimizing the RBD sequence of the wild-type novel coronavirus B.1.525 Nigerian mutant strain

[0041] On the basis of the wild-type novel coronavirus RBD amino acid sequence, the following optimization was performed to obtain the initially optimized RBD nucleotide sequence of the novel coronavirus B.1.525 Nigerian mutant strain:

[0042] The present invention optimizes the codons encoding the amino acid sequence in the coding sequence according to the genetic codon bias of Chinese hamster CHO cells;

[0043] Among them, according to the codon preference, the laboratory's previous experience in high-efficiency protein expression, mRNA secondary structure and other factors, the optimized SEQ ID NO.1 was obtained:

[0044] AGAGTGCAGCCAACAGAGAGCATCGTGAGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCAACAAGGTTCGCCAGCGTGTACGCCTGGAACAGAAAAAGGATCAGCAACTGCGTGGCAGACTACAGTGTGCTGTACAACTCCGCCTCCTTCTCCACCTTCAAATGCTATGGCGTGTCCCCCACCAAGCTGAACGATCTGTGTTTTACCAACGTGTACGCCGACTCC...

Embodiment 2

[0062] Example 2 Expression and purification of recombinant RBD protein

[0063]The complete target gene shown in SEQ ID NO.6 is subjected to Nhel / Notl double enzyme digestion, and then connected to the pcDNA3.1+ eukaryotic expression vector through the same enzyme digestion to obtain a recombinant vector. The plasmid structure is as follows: figure 1 shown.

[0064] The recombinant vectors were transformed into Escherichia coli respectively, and the plasmids were amplified according to conventional methods, and then the plasmids were extracted with a kit from Tiangen Biological Co., Ltd.

[0065] Transfect Chinese hamster CHO cells: prepare according to the Lipofectin kit manual to obtain a DNA-liposome mixture, add it to Chinese hamster CHO cells cultured in DMEM medium, and incubate at 37°C for 2 hours; replace the medium with DMEM containing 10% FBS Medium, continue to culture for 48h.

[0066] Screening of Neomycin-resistant clones: Separate the transfected cells from ...

Embodiment 3

[0077] Example 3 Mouse Immunization Experiment

[0078] Twenty 6- to 8-week-old female BALB / c mice were randomly divided into the following groups:

[0079] Immunization group 1 (10 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used was 10 μg RBD+100 μg Al(OH) 3 , wherein, RBD is the novel coronavirus B.1.525 Nigerian mutant strain RBD glycoprotein expressed by the CHO cells prepared in Example 2, containing 10 μg RBD and 100 μg Al(OH) in a volume of 100 μL 3 Compatible vaccines with saline.

[0080] Immunization group 2 (5 μg immunization group): 100 μL vaccine was injected intramuscularly on days 0 and 14 respectively. The vaccine used was 5 μg RBD+100 μg Al(OH) 3 , wherein, wherein, RBD is the novel coronavirus B.1.525 Nigeria mutant strain RBD glycoprotein expressed by the CHO cells prepared in Example 2, containing 5 μg RBD and 100 μg Al(OH) in a volume of 100 μL 3 Compatible vaccines with saline.

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to a gene of a novel corona virus diease-2019 B.1.525 Nigera mutant strain RBD and application of the gene. The nucleotide sequence of the gene of the novel corona virus diease-2019 B.1.525 Nigera mutant strain RBD is as shown in SEQ ID NO. 1 or SEQ ID NO. 6. The gene sequence of the wild novel corona virus diease-2019 B.1.525 Nigera mutant strain RBD is optimized, a relatively optimal sequence is determined by combining screening, and the cloning expression efficiency generated by the optimized sequence is greatly improved compared with the expression efficiency of the wild novel corona virus diease-2019 B.1.525 Nigera mutant strain RBD sequence, so that the gene of the novel corona virus diease-2019 B.1.525 Nigera mutant strain RBD can be used for preparing a novel corona virus diease-2019 vaccine.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the gene of the RBD of the new coronavirus B.1.525 Nigerian mutant strain and its application. Background technique [0002] The 2019 novel coronavirus SARS-CoV-2, which causes novel coronavirus pneumonia COVID-19, is currently the seventh known coronavirus that can infect humans, and the remaining six are HCoV-229E, HCoV-OC43, and HCoV-NL63 , HCoV-HKU1, SARS-CoV (causing Severe Acute Respiratory Syndrome) and MERS-CoV (causing Middle East Respiratory Syndrome). [0003] Coronaviruses are a class of RNA viruses with an envelope and a linear single-stranded positive strand genome. They are a large class of viruses that exist widely in nature. Coronavirus particles are irregular in shape, with a diameter of about 60-220nm; the genome is about 27-32kb in length, and it is the virus with the largest genome among known RNA viruses. Virus particles are covered with a fatty me...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/50C12N15/85C12N5/10
CPCC07K14/005C12N15/85C12N2770/20022C12N2770/20034C12N2800/107C12N2800/22
Inventor 翟俊辉杜红王轲珑
Owner BIO-BANK CORP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products